View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11306_low_13 (Length: 231)
Name: NF11306_low_13
Description: NF11306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11306_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 19 - 186
Target Start/End: Complemental strand, 18161225 - 18161058
Alignment:
| Q |
19 |
cctgtgtgaatgtgttcaccaagatgattctgtcagcggtggaatcttccgtggcatgggaatcggaactatgatctgggttggtgttgtttgaagatga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18161225 |
cctgtgtgaatgtgttcaccaagatgattctgtcagtggtggaatcttccgtggcatgggaatcggaactatgatctgggtctgtgttgtttgaagatga |
18161126 |
T |
 |
| Q |
119 |
atgtgaaaggcttaacattctgatcgttctttcgaacagagaagaaatttcagcttctaaagccatcg |
186 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18161125 |
atgtgaaaggcttaacattctgatcattctttcgaacagagaagaaatttctgcttctaaagccatcg |
18161058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University