View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11308_high_3 (Length: 245)
Name: NF11308_high_3
Description: NF11308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11308_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 4 - 123
Target Start/End: Original strand, 47254822 - 47254941
Alignment:
| Q |
4 |
agtgacatgttgtttatataggaatgagatttggtcggaaattttgacagaaagagcggtttcagacaaacttttcagaaaatgaaaatgttggcgctat |
103 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47254822 |
agtgacatggtgtttatataggaatgagatttggtcggaaattttgacagaaagagcggtttcagacaaacttttcagaaaatgaaaatgttggcgctat |
47254921 |
T |
|
| Q |
104 |
tgaagttgtcttgaaaattt |
123 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
47254922 |
tgaagttgtcttgaaaattt |
47254941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 114 - 228
Target Start/End: Original strand, 47254965 - 47255079
Alignment:
| Q |
114 |
ttgaaaatttgggtactttttaattttaatgaaattttcgtgttgccgcgccgatgttcatttattttttgttacattgccgccttcaatttcgctctgc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47254965 |
ttgaaaatttgggtactttttaattttaatgaaattttcgtgttgccgcgccgatattcatttattttttgttacattgccgccttcaatttcgctctgc |
47255064 |
T |
|
| Q |
214 |
tgtccaaacccaact |
228 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
47255065 |
tgttcaaacccaact |
47255079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University