View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11309A_high_21 (Length: 287)

Name: NF11309A_high_21
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11309A_high_21
NF11309A_high_21
[»] chr5 (1 HSPs)
chr5 (7-231)||(34397854-34398076)
[»] chr3 (1 HSPs)
chr3 (243-276)||(36703138-36703171)


Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 7 - 231
Target Start/End: Original strand, 34397854 - 34398076
Alignment:
7 gttttcctccattgttgcatattcaagagcattggaggggttccgttatcttttaattcgattacataacatagcaacaagatgacaaaatcgactgtga 106  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34397854 gttttcctccattgttgcatattcaagagcattggaggggttccattatcttttaattcgattacataacatagcaacaagatgacaaaatcgactgtga 34397953  T
107 aagaaaatagtacataccataagaaaaaacaatgtttcgataaatgctcggttaaaagctacgttgtttttatgagagacccaagtcagatattttgcca 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||  |||||||| |||| |||||||||||    
34397954 aagaaaatagtacataccataagaaaaaacaatgtttcgataaatgctaggttaaaagctacattgtttttat--gagacccaggtcaaatattttgcca 34398051  T
207 aggactgaaataactattccctctt 231  Q
    ||||||||||||||||||| |||||    
34398052 aggactgaaataactattctctctt 34398076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 243 - 276
Target Start/End: Complemental strand, 36703171 - 36703138
Alignment:
243 gataatcgtttttctcccatctgtttttgttcat 276  Q
    |||||||||| |||||||||||||||||||||||    
36703171 gataatcgttcttctcccatctgtttttgttcat 36703138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University