View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_high_7 (Length: 458)
Name: NF11309A_high_7
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 168 - 444
Target Start/End: Original strand, 19477871 - 19478148
Alignment:
| Q |
168 |
ctagggtactgttggtacgc-tagccctatatatcattttgttataaaaattaaaaagatgaaatgtttcctcagattgagtctgttttagccgatgact |
266 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| ||||||| | |||||||| || |||| |||||||||||||||||||||| |||||| |
|
|
| T |
19477871 |
ctagggtactgttggtacgcctagccctatatatcattttgttgtaaaaataagaaagatgatatatttcttcagattgagtctgttttagccaatgact |
19477970 |
T |
 |
| Q |
267 |
aagcccttatcttttggaatataaagtgtacgatctgtttgatatcacggtaggtatgttaatatagtgatccacccttattttgcaagctgagaattga |
366 |
Q |
| |
|
|||||||||| ||||| |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19477971 |
aagcccttattttttgaaatataaaatgtataatctgtttgatatcacggtaggtatgttaatatagtgatccacccttattttgcaagctaagaattga |
19478070 |
T |
 |
| Q |
367 |
actattaatgaattgtaactacttgtttgtcccacaaatcattttctatttaccacatcatccttgtaattacttgtt |
444 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19478071 |
actattactgaattgtaactacttgtttgtcccacaaatcattttctatttaccacatcatccttgtaattacttgtt |
19478148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 22 - 86
Target Start/End: Original strand, 19477723 - 19477788
Alignment:
| Q |
22 |
tatggatggtctcaagcataaatgtattg-gatgaacgttccctaagattttgggatagtaggctt |
86 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
19477723 |
tatggatggtcttagacataaatgtatttagatgaacgtaccctgagattttgggatagtaggctt |
19477788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University