View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_111 (Length: 314)
Name: NF11309A_low_111
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_111 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 11 - 308
Target Start/End: Original strand, 29829583 - 29829880
Alignment:
| Q |
11 |
caaagacaaaattgagaaaatattactgttctagtctttttcttggattttataccactgattatggatgaatcattacccgtgtctttgaagtaaaaac |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
29829583 |
caaaaacaaaattgagaaaatattactgttctagtctttttcttggattttataccactgattatgtatgaatccttacccgtgtctttgaagtaaaaac |
29829682 |
T |
|
| Q |
111 |
ttcccatatctatttaaaatgcagcatgctacatcataaattccaaaatctcaattaaaaggattcacaatcttttgcaattgcatgcaataagttaaca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29829683 |
ttcccatatctatttaaaatgcagcatgctacatcataaattccaaaatctcaatcaaaaggattcacaatcttttgcaattgcatacaataagttaaca |
29829782 |
T |
|
| Q |
211 |
cattatatagtactattacacaagtcctacaaagcagcaacaacaacaaacatggaaaagaagaaagaaaattcaactagctatcttttggcactagg |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29829783 |
cattatatagtactattacacaagtcctacaaagcagcaacaacaacaaacatggaaaagaagaaaggaaattcaactagctatcttttggcactagg |
29829880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University