View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_128 (Length: 291)
Name: NF11309A_low_128
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_128 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 12 - 209
Target Start/End: Original strand, 25933216 - 25933416
Alignment:
| Q |
12 |
aatatagaactttaatttaaatgttttgtgactaagcatctcaataaatatccgtctcatagtcaaggagatggaataatgtttgattgttgtcgttttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25933216 |
aatatagaactttaatttaaatgttttgtgactaagcatctcaataaatatccgtctcatagtcaaggagatggaataatgtttgattgttgtcgttttt |
25933315 |
T |
|
| Q |
112 |
attaaactaagttgaacgccctttctctaaaaatcagaaagttaacatcaaaacacaataat---ggtttgttcttgaaaaatgattaatttaacataca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25933316 |
attaaactaagttgaacgccctttctctgaaaatcagaaagttaacatcaaaatacaataattacggtttgttcttgaaaaatgattaatttaacataca |
25933415 |
T |
|
| Q |
209 |
a |
209 |
Q |
| |
|
| |
|
|
| T |
25933416 |
a |
25933416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University