View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_137 (Length: 287)
Name: NF11309A_low_137
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_137 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 7 - 231
Target Start/End: Original strand, 34397854 - 34398076
Alignment:
| Q |
7 |
gttttcctccattgttgcatattcaagagcattggaggggttccgttatcttttaattcgattacataacatagcaacaagatgacaaaatcgactgtga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34397854 |
gttttcctccattgttgcatattcaagagcattggaggggttccattatcttttaattcgattacataacatagcaacaagatgacaaaatcgactgtga |
34397953 |
T |
 |
| Q |
107 |
aagaaaatagtacataccataagaaaaaacaatgtttcgataaatgctcggttaaaagctacgttgtttttatgagagacccaagtcagatattttgcca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |||||||| |||| ||||||||||| |
|
|
| T |
34397954 |
aagaaaatagtacataccataagaaaaaacaatgtttcgataaatgctaggttaaaagctacattgtttttat--gagacccaggtcaaatattttgcca |
34398051 |
T |
 |
| Q |
207 |
aggactgaaataactattccctctt |
231 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
34398052 |
aggactgaaataactattctctctt |
34398076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 243 - 276
Target Start/End: Complemental strand, 36703171 - 36703138
Alignment:
| Q |
243 |
gataatcgtttttctcccatctgtttttgttcat |
276 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
36703171 |
gataatcgttcttctcccatctgtttttgttcat |
36703138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University