View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_146 (Length: 280)
Name: NF11309A_low_146
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_146 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 9 - 280
Target Start/End: Original strand, 54877391 - 54877663
Alignment:
| Q |
9 |
gaaatgaaacggttgttcatgattctccggtgtggcggaggttgaatcttcaagatggaggagtgcagacatattaacactccaacgctcaagtcaatat |
108 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
54877391 |
gaaatggaacggttgttcatggttctccggtgtggcggaggttgaatcttcaaggtggaggagtgcagacatattaacactccaacgctcaagtcagtat |
54877490 |
T |
|
| Q |
109 |
ttgtggttatgtgcagaagtgtaccttgagggtg-cgttgaatcatccttatatagacgtagagagcgctaacggttcccgcaaagtggggcgcaatctt |
207 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
54877491 |
ttatggttatgtgcagaagtgtaccttgagggtgtcgttgaatcatccttatatagatgtagagagtgctaacggttcccacaaagtgtggcgcaatctt |
54877590 |
T |
|
| Q |
208 |
aggaggtcgttagagattacgtggacnnnnnnnatgtagtcaaggcgtactcatgggtggggatccggcaggg |
280 |
Q |
| |
|
|| ||||||||||||||||||||||| ||| ||||||||| |||||||| | || |||||| ||||| |
|
|
| T |
54877591 |
agaaggtcgttagagattacgtggacggtggatatggagtcaaggcatactcatgtgcggtgatccgacaggg |
54877663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 104
Target Start/End: Original strand, 18322943 - 18322975
Alignment:
| Q |
72 |
tgcagacatattaacactccaacgctcaagtca |
104 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
18322943 |
tgcagacatgttaacactccaacgctcaagtca |
18322975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University