View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_147 (Length: 278)
Name: NF11309A_low_147
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_147 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 8 - 272
Target Start/End: Original strand, 38643180 - 38643444
Alignment:
| Q |
8 |
tgaaatgaaatagtgagtagtagtattttagtaattcaacagaaacacaaggcttcttaaatataaatcacatgttaccatagctggcagcatatgaatc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38643180 |
tgaaatgaaatagtgagtagtagtattttagtaattcaacaaaaacacaaggcttcttaaatataaatcacatgttaccatagctggcagcatatgaatc |
38643279 |
T |
 |
| Q |
108 |
ctacattctcatccactgagcctgtcataaaagctagtacttagttgttagtttgcctctgctagttgccattattcacatttcactcaactcaccccaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38643280 |
ctacattctcatccactgagcctgtcataaaagctagtacttagttgttagtttgcctctgctagttgccattattcacatttcactcaactcaccccaa |
38643379 |
T |
 |
| Q |
208 |
gaataatggaacatagaagaaactcatcatggtttcttctattctcaactctttcttgtcttttt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38643380 |
gaataatggaacatagaagaaactcatcatggtttcttctattctcaactctttcttgtcttttt |
38643444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University