View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_154 (Length: 275)
Name: NF11309A_low_154
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_154 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 7 - 275
Target Start/End: Complemental strand, 30590491 - 30590224
Alignment:
| Q |
7 |
aacacagatacaaaaccagagtggttgagaaatctcttggagaagaagctggaattaaatctgccaccatcgaagttgaaggccgttatgcgtatgggta |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590491 |
aacaaagatacaaaaccagagtggttgagaaatctcttggagaagaagctggaattaaatctgccaccatcgaagttgaaggccgttatgcgtatgggta |
30590392 |
T |
|
| Q |
107 |
tttgtctggggagaaaggaacccatcgcattgttcggcagtccacttttaattcaaaaggtcttcgtcaggtaacaaccgactctttttgctagctgaat |
206 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590391 |
tttgtctggggagaaaggaacacatcgcattgttcggcagtccccttttaattccaaaggtcttcgtcaggtaacaaccgactctttttgctagctgaat |
30590292 |
T |
|
| Q |
207 |
gtcagattgcttgatcagttcccnnnnnnntcccagtgaaagtgctgctgtagactgcaatagcaatga |
275 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590291 |
gtcagattgcttgatcagttcccaaaaaaa-cccagtgaaagtgctgctgtagactgcaatagcaatga |
30590224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University