View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_169 (Length: 266)
Name: NF11309A_low_169
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_169 |
 | |
|
| [»] scaffold1075 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 5 - 187
Target Start/End: Original strand, 33535378 - 33535560
Alignment:
| Q |
5 |
aagaagcacagaaccagtagcagatttctgacccagaagtgcaaatgaattatgtgttgttaaccatgaatatcgattaaacggcaaccccttcacctac |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| || |||| |
|
|
| T |
33535378 |
aagaatcacagaaccagtagcagatttctgacccagaagtgcaaatgaattatgtgttgttaaccatgaataccgattaaatggcaacccttttacctgt |
33535477 |
T |
|
| Q |
105 |
ataaaaaccaatactttacaatgttaggtaccaaaccaacacattcatagcacaataaaactccaaaatgaacataacaataa |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
33535478 |
ataaaaaccaatactttacaatgttaggtaccaaaccaacacattcatagcacaggaaaacttcaaaatgaacataacaataa |
33535560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1075 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: scaffold1075
Description:
Target: scaffold1075; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 194 - 266
Target Start/End: Original strand, 898 - 970
Alignment:
| Q |
194 |
catcatatgtagtcagtcttgctaattgtatatgggtggtatcattagagaatatttgttctaaattttgtga |
266 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
898 |
catcatatgtagtcggtcttgctaattgtatatgtgtggtatcattagagaatatttgttctaaattttgtga |
970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 45 - 102
Target Start/End: Original strand, 6215443 - 6215500
Alignment:
| Q |
45 |
gcaaatgaattatgtgttgttaaccatgaatatcgattaaacggcaaccccttcacct |
102 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||| || |||||||||| |
|
|
| T |
6215443 |
gcaaatgaattatgtgtcgttaaccatgaataccgattaaacggtaaacccttcacct |
6215500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University