View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_173 (Length: 265)
Name: NF11309A_low_173
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_173 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 7 - 246
Target Start/End: Original strand, 9443303 - 9443542
Alignment:
| Q |
7 |
taagatatgtgattttatggaaaattgcatccaaagttgattctaactcgaaactagaacttatagtttttgtctctaccattgatttttattcttaaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9443303 |
taagatatgtgattttatggaaaattgcttccaaagttgattctaactcgaaactagaacttatagtttttgtctctaccattgatttttattcttaaat |
9443402 |
T |
|
| Q |
107 |
ttatcgtttagttttagcgcatgtttgttaacctggtatactaccatgatttttgcgaagccggaaatcagagggttgggaaacatacgaacaaacactg |
206 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9443403 |
ttatggtttagttttagcgcatgtttgtaaacctggtatactaccatgatttttgcgaagccggaaatcagagagttgggaaacatacgaacaaacactg |
9443502 |
T |
|
| Q |
207 |
atgtagccatgattaattttttataaccaattcattcaaa |
246 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9443503 |
atgtagccatgattaagtttttataaccaattcattcaaa |
9443542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University