View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_174 (Length: 265)
Name: NF11309A_low_174
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_174 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 265
Target Start/End: Original strand, 34335482 - 34335733
Alignment:
| Q |
13 |
agatggagttccctaatggaccgtttcttaagtttgagaaagatatttcagcagttttggaatttatctaccagacacaaatagagttagctgcatgtga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34335482 |
agatggagttccctaatggaccgtttcttaagtttgagaaagatatttcagcagttttggaatttatctaccagacgcaaatagagttagctgcatgtga |
34335581 |
T |
|
| Q |
113 |
gtaatttcattcttgaaatgctaggtatcacatgatacatgcaagttgtatcttaatccgaatcaaaatcgaactcaacgaatacaaatgttatatgatt |
212 |
Q |
| |
|
|||||| |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34335582 |
gtaattccattcttg-aatgttaggtatcacatgatacatgcaagttgtatcttaatccgaatcaaaatcgaactcaacgaacacaaatgttatatgatt |
34335680 |
T |
|
| Q |
213 |
ggttttggagaaattacannnnnnnnaacttgaatttgagcaggtagtgatga |
265 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34335681 |
ggttttggagaaattacattttttttaacttgaatttgagcaggtagtgatga |
34335733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University