View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_175 (Length: 264)
Name: NF11309A_low_175
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_175 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 24 - 249
Target Start/End: Original strand, 47526681 - 47526906
Alignment:
| Q |
24 |
atataacataagtgagaaagaaagagaagaaaatggaaagagtgttatcaattgctgaaataacggagcaatattggttgacctcgaaagcgtgcaaggg |
123 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47526681 |
atataacataggtgagaaagaaagagaagaaaatggaaagagtgttatcaattgctgaaataacggagcaatattggttgacctcgaaagcgtgcaaggg |
47526780 |
T |
|
| Q |
124 |
aggagacacaaagatgaatcggagtgattcagaatgggctttccaaaagtttttacgtgaacaagaagctgctgaagaagcagaagctgctactgcaaag |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47526781 |
aggagacacaaagatgaatcggagtgattcagaatgggctttccaaaagtttttacgtgaacaagaagctgctgaagaagcagaagctgctactgcaaag |
47526880 |
T |
|
| Q |
224 |
ccttcttcatcatcaactccaacttc |
249 |
Q |
| |
|
|||||||||||||||||| ||||||| |
|
|
| T |
47526881 |
ccttcttcatcatcaacttcaacttc |
47526906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University