View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_195 (Length: 254)
Name: NF11309A_low_195
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_195 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 9 - 249
Target Start/End: Original strand, 28675596 - 28675836
Alignment:
| Q |
9 |
aacaatatggcaacaaaagagagtatgtgggacccaccaaaaacggcagcggcatttactcggagctccgtcaccggaggagggacgaccctttttagtg |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28675596 |
aacaaaatggcaacaaaagagagtatgtgggacccaccaaaaagggcagcggcatttactcggagctccgtcaccggaggagggacgaccctttttagtg |
28675695 |
T |
 |
| Q |
109 |
gtgggttgtttggaggagcgtttaactcgaacttgacccatgcaagtgactctaggggaagaaggttctttggtttcaatggaagtagtgttctttttcc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28675696 |
gtgggttgtttggaggagcgtttaactcgaacttgacccatgcaagtgactttaggggaagaaggttctttggtttcaatggaagtagtgttctttttcc |
28675795 |
T |
 |
| Q |
209 |
ttaggattaagaacatagagttagactttgatcttgttctt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28675796 |
ttaggattaagaacatagagttagactttgatcttgttctt |
28675836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 139 - 178
Target Start/End: Complemental strand, 40638148 - 40638109
Alignment:
| Q |
139 |
acttgacccatgcaagtgactctaggggaagaaggttctt |
178 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40638148 |
acttgacccatgcaagtgactttaggggaagaaggttctt |
40638109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University