View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_206 (Length: 250)
Name: NF11309A_low_206
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_206 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 37887868 - 37887656
Alignment:
| Q |
1 |
ttcatcagttatcactttcttctcttgatcatcctggctttaacaggaggcaagggagatgtagctctatataactcatcaatattaacgtaacgatacc |
100 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37887868 |
ttcatcggttatcattttcttctcttgatcatcctggctttaacaggaggcaaaggagatgtagctctatataactcatcaatattaacgtaacgatacc |
37887769 |
T |
|
| Q |
101 |
ttttatttgttcttgcaacgcaactttcagaatctgacaaaacagtagatgatgatacagcatcaccaccggaatcaaccttgttgtgactcacgctata |
200 |
Q |
| |
|
| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37887768 |
tcttatttgttcttgcaaagcaactttcagaatctgacaaaacagtagatgatgatacaacatcaccaccggaatcaaccttgttgtgactcacgctata |
37887669 |
T |
|
| Q |
201 |
gctattgctattg |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
37887668 |
gctattgctattg |
37887656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University