View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_222 (Length: 248)
Name: NF11309A_low_222
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_222 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 12 - 231
Target Start/End: Complemental strand, 24301265 - 24301046
Alignment:
| Q |
12 |
aaatatgttggaagtgttggagtggactctgatcaatgttgaagaaaagtttcctcgttgagttgaaaaaagctcatcaatagctctaaacagatgctca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || | ||||||||| ||| |||| |||||| ||| || |
|
|
| T |
24301265 |
aaatatgttggaagtgttggagtggactctgatcaatgttgaagaaaagtttctccgttaagcgtatgaaagctcataaatggctccaaacaggtgcgca |
24301166 |
T |
|
| Q |
112 |
tccgaacccacactgcgggcttcgaagcccaaatgaaaattggtacaagaatgagcataaagttaaagatattttactaggttgtagggttggaaataaa |
211 |
Q |
| |
|
|| ||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24301165 |
tcataacccacactgcgggcttcaaagcccaagtgaaaattggtacaagaatgagcataaagttaaagatattttactaggttgtatggttggaaataaa |
24301066 |
T |
|
| Q |
212 |
atatgatatgtctaaattga |
231 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
24301065 |
atatgatatgtctaagttga |
24301046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University