View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_230 (Length: 246)
Name: NF11309A_low_230
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_230 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 246
Target Start/End: Complemental strand, 33735240 - 33735008
Alignment:
| Q |
13 |
gaacataagtacaattccaaaaatttgttcaaagcttccgattatccatttctttaatgatgataggaggatctgatgatcgaggttgtgccactcaact |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33735240 |
gaacataagtacaattccaaaaatttgttcaaagcttccgattatccatttatttaaggatgataggaggatctgatgatcgaggttgtgccactcaact |
33735141 |
T |
|
| Q |
113 |
taattattctttgagagaaacgaatagcaaagacccccgatccttgtcgaaaacaatattatttgaaataccatgcaacttcaccagaatgtgcatgaag |
212 |
Q |
| |
|
|||| | ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33735140 |
taataaaa-tttgagagaaacgaatattaaagacccccgatccttatcgaaaacaatattatttgaaataccatgcaacttcaccagaatgtgtatgaag |
33735042 |
T |
|
| Q |
213 |
gtttcaacatccttagagctcgtgtactatgatt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
33735041 |
gtttcaacatccttagagctcgtgtactatgatt |
33735008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University