View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_254 (Length: 242)
Name: NF11309A_low_254
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_254 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 5 - 242
Target Start/End: Original strand, 36930481 - 36930713
Alignment:
| Q |
5 |
atgaacacaaacatgagagtgggatagctacgatatcatttaggaaaacagctgtgtagtgtagtgtgggacaaccataaacaaaatacatataaaaatc |
104 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||| |||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36930481 |
atgaacacacacatgagagtgggatagctacgataccattaaggaaaacagctgtgt-----agtgtgggacaaccataaactaaatacatataaaaatc |
36930575 |
T |
 |
| Q |
105 |
gaataacatattatttcacatcaaaataatttcataagaatgggatagctgctatgcctggaccttcaatgcgtgcatggctgaatcacggaaaacaaca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36930576 |
gaataacatattatttcacatcaaaataatttcataagaatgggatagctgctatgcctggaccttcaatgcgtgcatggctgaatgacggaaaacaaca |
36930675 |
T |
 |
| Q |
205 |
ttaacaaggtacaacaatagctgtgtggtgtggagcaa |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36930676 |
ttaacaaggtacaacaatagctgtgtggtgtggggcaa |
36930713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University