View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_261 (Length: 241)
Name: NF11309A_low_261
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_261 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 11 - 223
Target Start/End: Original strand, 26933440 - 26933652
Alignment:
| Q |
11 |
agtagcatagaagataagtggcctaatattccaattattactgcacgcttctcaaccataaaaatctgtttagagtttatttgcacccccatcttaaaga |
110 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26933440 |
agtaccatagaagataagtggcctgatattccaattattactgcacgcttctcaaccataaaaatctgtttagagtttatttgcacccccatcttaaaga |
26933539 |
T |
|
| Q |
111 |
aataaattatcattccaaattctgcaaatgttgaaagtatcattatgcttgctgttggaaataacatctcaaaacttgtgttgtctcgacccaaaaataa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26933540 |
aataaattatcattccaaattctgcaaatgttgaaagtatcattatgcttgctgttggaaataacatctcaaaacttgtgttgtctcgacccaaaaataa |
26933639 |
T |
|
| Q |
211 |
tggacccactatg |
223 |
Q |
| |
|
||||||||||||| |
|
|
| T |
26933640 |
tggacccactatg |
26933652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University