View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_286 (Length: 235)
Name: NF11309A_low_286
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_286 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 19 - 217
Target Start/End: Complemental strand, 15450235 - 15450037
Alignment:
| Q |
19 |
agtttacaaggaggcctaattgagaatgaccatattatgtaatcctttatcagccatccgaaagttattgaatataaacaaccttaggccccgatgttgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
15450235 |
agtttacaaggaggcctaattgagaatgaccatattatgtaatcctttctcagccatccggaagatattgaatataaacaaccttaggccccgatgttag |
15450136 |
T |
 |
| Q |
119 |
gaagagtagtgaatgaccaagggataatcgtccgagacatcatgggggaggcttcggtgactcataattgtcgcacttatcccacaatccttagaacac |
217 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
15450135 |
gaagagtagcgaatgaccaagggacaatcgtccgagacatcatgggggaggcttcgttgactcatagctgtcgcacctatcccacaatccttagaacac |
15450037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University