View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_290 (Length: 233)
Name: NF11309A_low_290
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_290 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 45343284 - 45343507
Alignment:
| Q |
1 |
gttgtgtacgcactgatagtgg-ctgataatgcaccgcaaatgagtttaatgaaattggtaaaatcaatggcataagcaggcaactgacaacattctaca |
99 |
Q |
| |
|
||||||||||||||||||| || | || ||| |||| |||||| |||||||||| || ||||| ||||||||||||| |||||||| ||||||| ||||| |
|
|
| T |
45343284 |
gttgtgtacgcactgatagggggcggagaattcacctcaaatgtgtttaatgaattttgtaaa-tcaatggcataagtaggcaacttacaacatcctaca |
45343382 |
T |
|
| Q |
100 |
ctccacaacaaaatggcgtagcgtagcgcaaaaatcggaccattaagaatatggttcggtgcatgctttgtgacaaacaagtaccgaagtcattttggcc |
199 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45343383 |
ctccacaacaaaatggcgtagcggagcgcaaaaatcggaccattatgaatatggttcggtgcatgctttgtgacaaacaagtaccgaagtcattttggtt |
45343482 |
T |
|
| Q |
200 |
agaagctgcaaaatggacagttcat |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45343483 |
agaagctgcaaaatggacagttcat |
45343507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University