View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_300 (Length: 230)
Name: NF11309A_low_300
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_300 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 181 - 224
Target Start/End: Original strand, 23598863 - 23598906
Alignment:
| Q |
181 |
cattgcgtatatttgtttgggattgtgagaactgataatgatat |
224 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23598863 |
cattacgtatatttgtttgggattgtgagaactgataatgatat |
23598906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 52
Target Start/End: Original strand, 23598831 - 23598864
Alignment:
| Q |
19 |
cctgccattttgtgcttcttttcccattttccca |
52 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
23598831 |
cctgccattttttgcttcttttcccattttccca |
23598864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University