View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_301 (Length: 230)
Name: NF11309A_low_301
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_301 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 33900778 - 33901001
Alignment:
| Q |
1 |
tagcattaggaacaaatgcagcttatttctattctgtttatgttgttggaagagctacattttcttcccatttcgaaggaagtgannnnnnngaaacaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33900778 |
tagcattaggaacaaatgcagcttatttctattctgtttatgttgttggaagagctacattttcttcccatttcgaaggaagtgatttttttgaaacaag |
33900877 |
T |
|
| Q |
101 |
ttctatgcttatttcttttattctacttggcaagtatttggaagtgttggctaaagggaaaacatcacaagctattgcgaaactcatggatttaacacct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33900878 |
ttctatgcttatttcttttattctacttggcaagtatttggaagtgttggctaaagggaaaacatcacaagctattgcgaaactcatggatttaacacct |
33900977 |
T |
|
| Q |
201 |
gatacagcaaccttactaactctt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33900978 |
gatacagcaaccttactaactctt |
33901001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 113 - 224
Target Start/End: Original strand, 33918416 - 33918527
Alignment:
| Q |
113 |
ttcttttattctacttggcaagtatttggaagtgttggctaaagggaaaacatcacaagctattgcgaaactcatggatttaacacctgatacagcaacc |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33918416 |
ttcttttattctatttggcaagtatttggaagtgttggctaaagggaaaacatcacaagctattgcgaaactcatggatttaacacctgatacagcaacc |
33918515 |
T |
|
| Q |
213 |
ttactaactctt |
224 |
Q |
| |
|
|||||||||||| |
|
|
| T |
33918516 |
ttactaactctt |
33918527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 9 - 41
Target Start/End: Complemental strand, 2782000 - 2781968
Alignment:
| Q |
9 |
ggaacaaatgcagcttatttctattctgtttat |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2782000 |
ggaacaaatgcagcttatttctattctgtttat |
2781968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University