View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_304 (Length: 230)
Name: NF11309A_low_304
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_304 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 64 - 224
Target Start/End: Original strand, 33399827 - 33399989
Alignment:
| Q |
64 |
aggacagctgattccttccttttgaggtgctataaattgtccaaattcctatttcctctagtcacccgaatgacatttctcatgcggggagctaacaaga |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399827 |
aggacagctgattccttccttttgaggtgctataacttgtccaaattcctatttcctctagtcacccgaatgacatttctcatgcggggagctaacaaat |
33399926 |
T |
 |
| Q |
164 |
gtggcttcttttcgttgtagtcttcacataaattcttgaaga--atagaaatgaatctcttca |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
33399927 |
gtggcttcttttcgttgtagtcttcacataaattcttgaagatcatagaaatgaatcttttca |
33399989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 39 - 107
Target Start/End: Complemental strand, 32492895 - 32492827
Alignment:
| Q |
39 |
tggacacaatgctcccccttcccttaggacagctgattccttccttttgaggtgctataaattgtccaa |
107 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32492895 |
tggacgcaatgcccccccttcccttaggacagctgattccttccttttgaggtgctataaattgtccaa |
32492827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 157 - 224
Target Start/End: Complemental strand, 32492828 - 32492759
Alignment:
| Q |
157 |
aacaagagtggcttcttttcgttgtagtcttcacata--aattcttgaagaatagaaatgaatctcttca |
224 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32492828 |
aacaagagtggcttcttttcgttgcagtcttcacatataaattcttgaagaatagaaatgaatctcttca |
32492759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 32493596 - 32493567
Alignment:
| Q |
1 |
ttgtttgcctaaaatgccttgcagcttgat |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32493596 |
ttgtttgcctaaaatgccttgcagcttgat |
32493567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University