View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_310 (Length: 230)
Name: NF11309A_low_310
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_310 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 21 - 142
Target Start/End: Complemental strand, 7345420 - 7345299
Alignment:
| Q |
21 |
atcttcgtagtaatctcttgtgacatgaacaattgtctttttattttacgttaaccctcctatttgcagaaaaggaccttgataagttggaattcgaccg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| || | || |
|
|
| T |
7345420 |
atcttcgtagtaatctcttgtgacatgaacaattgtctttttattttacgttaaccctcctatttgcagagaaggaccttgataatttggagtttggtcg |
7345321 |
T |
|
| Q |
121 |
tggatcaaaatagtccgataaa |
142 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7345320 |
tggatcaaaatagtccgataaa |
7345299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 136 - 210
Target Start/End: Complemental strand, 7345112 - 7345038
Alignment:
| Q |
136 |
cgataaagaatgataatctgatcaaaaattgttccgtctaagaatcaaacctactttctttcaatcaattcgtct |
210 |
Q |
| |
|
||||||| |||||||||||||||||| |||||| |||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
7345112 |
cgataaaaaatgataatctgatcaaagattgtttcgtctaggaatcaaacctactttctttcaatcgattcgtct |
7345038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 184
Target Start/End: Complemental strand, 35257586 - 35257550
Alignment:
| Q |
148 |
ataatctgatcaaaaattgttccgtctaagaatcaaa |
184 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
35257586 |
ataatctgatcaagaattgttccatctaagaatcaaa |
35257550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University