View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_316 (Length: 229)
Name: NF11309A_low_316
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_316 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 6 - 229
Target Start/End: Original strand, 29280091 - 29280303
Alignment:
| Q |
6 |
attttaatcatataattatttggaacacagtttaaatcatgattttaaattgtggttacgctgcaaacctttgtaccataaaaaaggcagctgatgtggt |
105 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29280091 |
attttaatcttataattatttggaacaaagtttaaatcatgattttaaattgtggttaggctgcaaacctttgtaccataaaaaa-gcagctgatgtggt |
29280189 |
T |
 |
| Q |
106 |
ctaatggttgtgataccgttgc--agacctcaaaactttttatattgcgactgcaattgcgattgctaacaatttaaacaatggttcaaaattctttgac |
203 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||| |||||| ||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
29280190 |
ctaatggttgtgataccattgcagagacctcaaaaccttttat------------attgcgattgccaacaatttaaacaatggttcaaaattctttaac |
29280277 |
T |
 |
| Q |
204 |
gacagttgtaaaatggccattagtga |
229 |
Q |
| |
|
|||||||||||||||| ||||||||| |
|
|
| T |
29280278 |
gacagttgtaaaatggtcattagtga |
29280303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 73
Target Start/End: Original strand, 42945056 - 42945084
Alignment:
| Q |
45 |
tgattttaaattgtggttacgctgcaaac |
73 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42945056 |
tgattttaaattgtggttacgctgcaaac |
42945084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University