View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_317 (Length: 229)
Name: NF11309A_low_317
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_317 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 123 - 224
Target Start/End: Complemental strand, 45818192 - 45818091
Alignment:
| Q |
123 |
aaattgagtatctcttcatgcaacaatagtgattaatctcgttgaatatgatcataataaatgagaaagttatccttacaaagaaattttgaattcaaac |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45818192 |
aaattgagtatctcttcatgcaacaatagtgattaatctcgttgaatatgatcataataaatgagaaagttatccttacaaagaaattttgaattcaaac |
45818093 |
T |
|
| Q |
223 |
ct |
224 |
Q |
| |
|
|| |
|
|
| T |
45818092 |
ct |
45818091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 35 - 103
Target Start/End: Complemental strand, 45818287 - 45818219
Alignment:
| Q |
35 |
ccagctttaagtttttaattaagagaatgaaaatgaaagacatgcatttttattatttctctaatctta |
103 |
Q |
| |
|
||||| ||||| | ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45818287 |
ccagcgttaagatcttaattaagagaatgaaaatgaaaggcatgcatttttattatttctctaatctta |
45818219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University