View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_318 (Length: 229)
Name: NF11309A_low_318
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_318 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 28 - 210
Target Start/End: Complemental strand, 55654648 - 55654467
Alignment:
| Q |
28 |
taagatcacgtcaccaatatgatgatggtagagttggcaacatcactttacttagaaaaacaatctaggttcaattcatggagtcgcacatttggaagac |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55654648 |
taagatcacgtcaccaatatgatgatggtagagttggcaacatcactttacttagaaaaacaatctaggttcaattcatggagtcgcacatttggaagat |
55654549 |
T |
 |
| Q |
128 |
atagtattagcgatcgttaactcaaaaattaatcttatagcggattcaaattggtcaatatatacaagagtgtgtttgatatt |
210 |
Q |
| |
|
||||| || |||||||||||| ||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
55654548 |
atagt-ctaacgatcgttaacttaaaaattaatcttatagtggatttaaattggtcaatatatacgagagtgtgtttgatatt |
55654467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University