View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_325 (Length: 228)
Name: NF11309A_low_325
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_325 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 181 - 222
Target Start/End: Complemental strand, 24984731 - 24984690
Alignment:
| Q |
181 |
taattagaaactatatgataacataattgtaaataactatat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24984731 |
taattagaaactatatgataacataattgtaaataactatat |
24984690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 39 - 70
Target Start/End: Original strand, 35789279 - 35789310
Alignment:
| Q |
39 |
tttttggtataaagttgattatttaagattga |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35789279 |
tttttggtataaagttgattatttaagattga |
35789310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University