View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_329 (Length: 227)
Name: NF11309A_low_329
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_329 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 37 - 207
Target Start/End: Complemental strand, 31798862 - 31798689
Alignment:
| Q |
37 |
aattgattttaattgctagttcgattgctcagtagaacaattcttgcaagattttgttt--atataattcaagtagnnnnnnnnnnn-aataggaattca |
133 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||||||||| |
|
|
| T |
31798862 |
aattgattttaattactagttcgattgctcagtagaacaattcttgcaagattttttttttatataattcaagtagttttttttttttaataggaattca |
31798763 |
T |
 |
| Q |
134 |
agtaggcaatttgaagattcaagttcaatcacgaaataatggatggtccatgaaaatcttatgacaaagccact |
207 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31798762 |
agtaggcaatttgtagattcaagttcaatcacgaaataatggatggtccatgaaaatcttatgacaaagccact |
31798689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University