View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_349 (Length: 218)
Name: NF11309A_low_349
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_349 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 88 - 213
Target Start/End: Complemental strand, 40660096 - 40659971
Alignment:
| Q |
88 |
gtcatgctttgtgaaggttgaacttggttgttgtcctgtttggagcctatggtttacagggcatgtaggaattgggtatcagcttgatagtagtgtgcaa |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40660096 |
gtcatgctttgtgaaggttgaacttggttgttgtcctgtttggagcctatggtttacagggcatgtaggaattgggtatcagcttgatagtagtgtgcaa |
40659997 |
T |
|
| Q |
188 |
gccaaatgttccatgatgtgcttctt |
213 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40659996 |
gccaaatgttccatgatgtgcttctt |
40659971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 10 - 58
Target Start/End: Complemental strand, 40660175 - 40660127
Alignment:
| Q |
10 |
acatcactgctgcaggatttaaaaggtggtgtgtggctagtggtgcaga |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40660175 |
acatcactgctgcaggatttaaaaggtggtgtgtggctagtggtgcaga |
40660127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University