View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_353 (Length: 217)
Name: NF11309A_low_353
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_353 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 17 - 197
Target Start/End: Complemental strand, 54978329 - 54978146
Alignment:
| Q |
17 |
aatatcaaaaccgcattcatcacgcatcaattcagagtcacaaccccaaatagcacatctagaactttttgccccggccatatgtggatgcttgtccaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
54978329 |
aatatcaaaaccgcattcatcacgcatcaattcagagtcacaaccccaaatagcacatctagaactttttgccccggccatatgtggatggttgtccaaa |
54978230 |
T |
|
| Q |
117 |
ccgttactcaactttctacgcttatggtt---gtcgaatctttctggcgaatccattggttggttatcaggagttggtggtgtc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54978229 |
ccgttactcaactttctacgcttatggttgcagtcgaatctttctggcgaatccattggttggttatcaggagttggtggtgtc |
54978146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University