View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_355 (Length: 216)
Name: NF11309A_low_355
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_355 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 14 - 216
Target Start/End: Original strand, 12684745 - 12684947
Alignment:
| Q |
14 |
gatgaacaaggctatgaaggttcatggtatcctgcaactgttgttgatttatatcaaaatggaaagtacttggtggagtattcaaccttgaaaacagatg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12684745 |
gatgaacaaggctatgaaggttcatggtatcctgcaactgttgttgatttatatcaaaatggaaagtacttggtggagtattcaaccttgaaaacagatg |
12684844 |
T |
|
| Q |
114 |
acttaattcaacagctgaaagaagtggtggatgtttcggatatcagaccgcgtccaccagatatcgatcatttttgtcgatatgtgaggcaggaatgggt |
213 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12684845 |
acttaactcaacagctgaaagaagtggtagatgtttcggatatcagaccgcgtccaccagatatcgatcatttttgtcgatatgtgaggcaggaatgggt |
12684944 |
T |
|
| Q |
214 |
tga |
216 |
Q |
| |
|
||| |
|
|
| T |
12684945 |
tga |
12684947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University