View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_358 (Length: 216)
Name: NF11309A_low_358
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_358 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 15 - 198
Target Start/End: Original strand, 31997905 - 31998088
Alignment:
| Q |
15 |
aagaatatgcctcgtggatgtggacttgcataataggaggtggtctttctggagggaaaaatgtgcctctggaaggaagtatattagctgctaaatttca |
114 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31997905 |
aagaaaatgcctcgtggacgtggacttgcataataggaggtggtctttctggagggaaaaatgtgcctctggaaggaagtatattagctgctaaatttct |
31998004 |
T |
 |
| Q |
115 |
tggtaacagttggtttgtttatctttctggctctgcataagcattggattttaannnnnnnaatcaatgtcttttgacctattt |
198 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |||||||||||| |||| | |||||||||||||||| |
|
|
| T |
31998005 |
tggtcacagttggtttgtttatctttctggctctgcataagaattggattttaatttttttaatcgaagtcttttgacctattt |
31998088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 12 - 106
Target Start/End: Original strand, 15843026 - 15843120
Alignment:
| Q |
12 |
tcgaagaatatgcctcgtggatgtggacttgcataataggaggtggtctttctggagggaaaaatgtgcctctggaaggaagtatattagctgct |
106 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||| |||||| ||||||| ||||||| |||||||||||||| ||||||| |||| ||||| |
|
|
| T |
15843026 |
tcgaagaaaatacctcgtggatgtggacttgcatagtaggagatggtcttgttggagggggcaatgtgcctctggagggaagtacattacctgct |
15843120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University