View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_363 (Length: 211)
Name: NF11309A_low_363
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_363 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 23 - 188
Target Start/End: Complemental strand, 45344718 - 45344553
Alignment:
| Q |
23 |
tcttaaagctttcaaacatgcatgcatcattcccagtaaagattaaatcatcaacatacaaactcacaattaaaattcttttacctcctgttttgacaaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45344718 |
tcttaaagctttcaaacatgcatgcatcattcccagtaaagattaaatcatcaacatacaaactcacaattaaaattcttttacctcctgttttgacaaa |
45344619 |
T |
 |
| Q |
123 |
gagagtatgatcatgattgcatctttcaaatccttccttagcaaaatatgattcaattttactata |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45344618 |
gagagtatgatcatgattgcatctttcaaatcattccttagcaaaatatgattcaattttactata |
45344553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 47 - 94
Target Start/End: Original strand, 1154906 - 1154953
Alignment:
| Q |
47 |
catcattcccagtaaagattaaatcatcaacatacaaactcacaatta |
94 |
Q |
| |
|
||||||| |||||||| || |||||||||||||||||||| ||||||| |
|
|
| T |
1154906 |
catcattgccagtaaatatcaaatcatcaacatacaaacttacaatta |
1154953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University