View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_377 (Length: 205)
Name: NF11309A_low_377
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_377 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 20 - 191
Target Start/End: Original strand, 41386973 - 41387147
Alignment:
| Q |
20 |
gtagaaatagatgtaataagtaatggtgagaaaatttaacatgnnnnnnnna---aaattgtttggaattgcacttggtgttgtctttcaatgcagtgag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41386973 |
gtagaaatagatgtaataagtaatggtgagaaaatttaagatgttttttttttttaaattgtttggaattgcacttggtgttgtctttcaatgcactgag |
41387072 |
T |
 |
| Q |
117 |
aaggaatgtatggtttgtgcagattttgaaagacaatggcagacgcggaggatattcagccactggtctatgata |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
41387073 |
aaggaatgtatggtttgtgcagattttgaaagacaatggcagacgccgaggatattcagccactggtctgtgata |
41387147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University