View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11309A_low_377 (Length: 205)

Name: NF11309A_low_377
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11309A_low_377
NF11309A_low_377
[»] chr2 (1 HSPs)
chr2 (20-191)||(41386973-41387147)


Alignment Details
Target: chr2 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 20 - 191
Target Start/End: Original strand, 41386973 - 41387147
Alignment:
20 gtagaaatagatgtaataagtaatggtgagaaaatttaacatgnnnnnnnna---aaattgtttggaattgcacttggtgttgtctttcaatgcagtgag 116  Q
    ||||||||||||||||||||||||||||||||||||||| |||            |||||||||||||||||||||||||||||||||||||||| ||||    
41386973 gtagaaatagatgtaataagtaatggtgagaaaatttaagatgttttttttttttaaattgtttggaattgcacttggtgttgtctttcaatgcactgag 41387072  T
117 aaggaatgtatggtttgtgcagattttgaaagacaatggcagacgcggaggatattcagccactggtctatgata 191  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||    
41387073 aaggaatgtatggtttgtgcagattttgaaagacaatggcagacgccgaggatattcagccactggtctgtgata 41387147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University