View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_379 (Length: 204)
Name: NF11309A_low_379
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_379 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 32 - 149
Target Start/End: Complemental strand, 45559699 - 45559582
Alignment:
| Q |
32 |
tggtgttgaatgagatggaatccatgttgagtttatggaaggaggaactgatgtccagtgggacatgaatgacaagagtgctaccccatctgagttcagt |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45559699 |
tggtgttgaatgagatggaatccatgttgagtttatggaaggaggaactgatgtccagtgggacatgaatgacaagagtgctaccccatctgagttcagt |
45559600 |
T |
|
| Q |
132 |
gcacaaacagaaacagaa |
149 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
45559599 |
gcacaaacagaaacagaa |
45559582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University