View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_381 (Length: 203)
Name: NF11309A_low_381
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_381 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 27 - 145
Target Start/End: Original strand, 29352226 - 29352340
Alignment:
| Q |
27 |
tattcaattactatcaatcaaacctcaatcacactattaaacttgaattagggtaacaatattgtccgatatatacaattttaatatctgaatatattgg |
126 |
Q |
| |
|
||||||||||||| | |||||||| |||| |||||||||||||||||| || |||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
29352226 |
tattcaattactaccgatcaaaccccaattacactattaaacttgaatcagtgtaacaatattgtc---ta-atacaattttaatatctgaatatattgg |
29352321 |
T |
|
| Q |
127 |
tgtgtctattgtctaatat |
145 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
29352322 |
tgtgtctattatctaatat |
29352340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 115 - 181
Target Start/End: Original strand, 29338907 - 29338973
Alignment:
| Q |
115 |
tgaatatattggtgtgtctattgtctaatatgaacctccaaaacggaagtgactacagttcaaccgt |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29338907 |
tgaatatattggtgtgtctattgtctaatatgaacctccaaaacggaaatgactacagttcaaccgt |
29338973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 46 - 92
Target Start/End: Original strand, 29329014 - 29329060
Alignment:
| Q |
46 |
aaacctcaatcacactattaaacttgaattagggtaacaatattgtc |
92 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29329014 |
aaaccccaatcacactattaaacttgaattagtgtaacaatattgtc |
29329060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University