View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_41 (Length: 408)
Name: NF11309A_low_41
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_41 |
 | |
|
| [»] scaffold0007 (2 HSPs) |
| |
|
Alignment Details
Target: scaffold0007 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 218 - 408
Target Start/End: Complemental strand, 149871 - 149681
Alignment:
| Q |
218 |
gtgaaggtagaagcttccattgtccactatatcttggtctttttgtggttaaggatgtttcaaattgggtttcaaaaggtgaagaacttgcaccaccact |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149871 |
gtgaaggtagaagcttccattgtccactatatcttggtctttttgtggttaaggatgtttcaaattgggtttcaaaaggtgaagaacttgcaccaccact |
149772 |
T |
|
| Q |
318 |
tgaaacatataatggagttgaaataaaagggtttgttccacttccacttacaacaatttgttgtgatgttgatgattgttgatgttggtga |
408 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
149771 |
tgaaacatataatggagttgaaataaaagggtttgttccacttccacttacaacaatttgttgtgatgatgatgattgttgatgttggtga |
149681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 27 - 101
Target Start/End: Complemental strand, 150062 - 149988
Alignment:
| Q |
27 |
atttccttcttgacaaggcattggtgaatgatcatgagattgggatgaagttgtctctgatgaagaagcagctaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
150062 |
atttccttcttgacaaggcattggtgaatgatcatgagattgtgatgaagttgtctctgatgaagaagcagctaa |
149988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University