View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_58 (Length: 377)
Name: NF11309A_low_58
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_58 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 1 - 371
Target Start/End: Complemental strand, 10119906 - 10119532
Alignment:
| Q |
1 |
agagagaaggagtgttgcttttggtacaagcaaaaggaac-gcaaagcgccatatttctattaaaccgttatat----ctttaaagcaatgtaaaatatc |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10119906 |
agagagaaggagtgttgcttttggtacaagcaaaaggaaccgcaaagcgccatatttctattaaaccgttatatatatctttaaagcaatgtaaaatatc |
10119807 |
T |
 |
| Q |
96 |
aaacactcaaccatgttataaccgtccctatattttcatttcatgattcattcattattttcagtgatgttatcttgttcagtgtttcaaaaacccaaca |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10119806 |
aaacactcaaccatgttataaccgtccctatattttcattgcatgattcattcattattttcagtgatgttatcttgttcagtgtttcaaaaacccaaca |
10119707 |
T |
 |
| Q |
196 |
ggacggttcaatcggttgtaccttaaactgacggtttggttattttagcggttcaataccagtttcgttcgggttcaagcaatttaaggcagttgaacca |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10119706 |
ggacggttcaatcggttgtaccttaaactgacggtttggtta-tttagcggttcaatcccagtttcgttcgggttcaagcaatttaaggcagttgaacca |
10119608 |
T |
 |
| Q |
296 |
tgaaccatgaaccatgattcagaagttttgcttgtttgatgtcttatccgatttttaaaacattgatgtaattaat |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10119607 |
tgaaccatgaaccatgattcagaagttttgcttgtttgatgtcttatccgatttttaaaacattgatgtaattaat |
10119532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University