View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_6 (Length: 591)
Name: NF11309A_low_6
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 248 - 480
Target Start/End: Original strand, 4723787 - 4724014
Alignment:
| Q |
248 |
ttatccacttagtaatttccccatgatgtacctttggtttatatcaaggttcttactcaagaggtagtcacattttatagtgcacatttcacactatata |
347 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4723787 |
ttatccacttagtaattccccc-tgatgtacctttggtttatatcaaggttcttactcaaggggtagtcacattttatagtgcacatttcacactat--- |
4723882 |
T |
|
| Q |
348 |
tttattatcaaggttcacatcaatagtccaatttaaacaaatctcaatagttcatatatgtgaaacggtgataacgagccagattcacacaatagagaat |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4723883 |
-ttattatcaaggttcacatcaatagtccaatttaaacaaatctcaatagttcatatatgtgaaaccgtgataacgagccagattcacacaatagagaat |
4723981 |
T |
|
| Q |
448 |
caaccacataatacattcaagtagggttcatgt |
480 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4723982 |
caaccacataatacattcaagtagggttcatgt |
4724014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 542 - 574
Target Start/End: Original strand, 4724082 - 4724114
Alignment:
| Q |
542 |
atatgtttccaatatgtctcctatttctctttt |
574 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4724082 |
atatgtttccaatatgtctcctatttctctttt |
4724114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University