View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_68 (Length: 358)
Name: NF11309A_low_68
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_68 |
 |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |  |
|
| [»] scaffold0356 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 205 - 340
Target Start/End: Complemental strand, 11841872 - 11841737
Alignment:
| Q |
205 |
atcaagatcatgataaaaattcaaatgcaatcaatatagatttactattagagattgcttgaacagtacaatgattctatcttttaattagttgaacgat |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11841872 |
atcaagatcatgataaaaattcaaatgcaatcaatatagatttactattggagattgcttgaacagtacaatgattctatcttttaattagtctaacgat |
11841773 |
T |
 |
| Q |
305 |
ggttttttcattcgccgacaaaggttagacctttct |
340 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11841772 |
ggttttttcattcgccgacaaaggttcgacctttct |
11841737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 2 - 94
Target Start/End: Complemental strand, 11842080 - 11841988
Alignment:
| Q |
2 |
gcaaacatttacctgttgaagcattacctgacattgcgatcaaagaatgaatgcgcacttttgcagaccgaatagattgcaacttagagtgga |
94 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11842080 |
gcaaacatttacctgttgaagcattaccagacattgcgatcaaagaatggatgcgcacttttgcagactgaatagattgcaacttagagtgga |
11841988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 97 - 169
Target Start/End: Complemental strand, 11841962 - 11841890
Alignment:
| Q |
97 |
aattgtgtgaactgtgttaataactgctgccaaaaagatatctgaaaccatgcatcagataaactaattattc |
169 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11841962 |
aattgtgtgaactgtgttaataaccgctgccaaaaagatatctgaaaccatgcatcagataaactaattattc |
11841890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 271 - 340
Target Start/End: Complemental strand, 19345650 - 19345581
Alignment:
| Q |
271 |
tacaatgattctatcttttaattagttgaacgatggttttttcattcgccgacaaaggttagacctttct |
340 |
Q |
| |
|
|||||||||| |||| | ||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19345650 |
tacaatgattatatcctctaattagccgaacgatggttttttcattcgccgacaaaggttcgacctttct |
19345581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 208 - 292
Target Start/End: Complemental strand, 7059 - 6975
Alignment:
| Q |
208 |
aagatcatgataaaaattcaaatgcaatcaatatagatttactattagagattgcttgaacagtacaatgattctatcttttaat |
292 |
Q |
| |
|
||||| ||||||||||||||||| | ||||||||| |||||||||||||| || | ||||| |||| | ||||||||||||||| |
|
|
| T |
7059 |
aagatgatgataaaaattcaaattctatcaatataaatttactattagaggttattcgaacactacagtaattctatcttttaat |
6975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 208 - 292
Target Start/End: Complemental strand, 24764562 - 24764478
Alignment:
| Q |
208 |
aagatcatgataaaaattcaaatgcaatcaatatagatttactattagagattgcttgaacagtacaatgattctatcttttaat |
292 |
Q |
| |
|
||||| ||||||||||||||||| | ||||||||| |||||||||||||| || | ||||| |||| | ||||||||||||||| |
|
|
| T |
24764562 |
aagatgatgataaaaattcaaattctatcaatataaatttactattagaggttattcgaacactacagtaattctatcttttaat |
24764478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 2 - 64
Target Start/End: Complemental strand, 24069218 - 24069156
Alignment:
| Q |
2 |
gcaaacatttacctgttgaagcattacctgacattgcgatcaaagaatgaatgcgcacttttg |
64 |
Q |
| |
|
||||||||||||||||||||| ||| || |||| || |||||||| |||||||||||||||| |
|
|
| T |
24069218 |
gcaaacatttacctgttgaagaatttccggacaaagcaatcaaagagtgaatgcgcacttttg |
24069156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0356 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0356
Description:
Target: scaffold0356; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 4 - 85
Target Start/End: Complemental strand, 13050 - 12969
Alignment:
| Q |
4 |
aaacatttacctgttgaagcattacctgacattgcgatcaaagaatgaatgcgcacttttgcagaccgaatagattgcaact |
85 |
Q |
| |
|
|||||||||||||| ||| |||| || |||||||| ||||||||||| ||||| |||||||||| |||| |||||||||| |
|
|
| T |
13050 |
aaacatttacctgtcgaaacattgccggacattgcaatcaaagaatgtatgcgggcttttgcagattgaatcgattgcaact |
12969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 4 - 89
Target Start/End: Complemental strand, 15821084 - 15820999
Alignment:
| Q |
4 |
aaacatttacctgttgaagcattacctgacattgcgatcaaagaatgaatgcgcacttttgcagaccgaatagattgcaacttaga |
89 |
Q |
| |
|
||||| |||| ||| || ||||| || |||||||| |||||||| |||||||||||||||| ||| |||| |||||||||||||| |
|
|
| T |
15821084 |
aaacaattacatgtcgaggcattgccggacattgcaatcaaagagtgaatgcgcacttttgtggactgaatggattgcaacttaga |
15820999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 279 - 339
Target Start/End: Complemental strand, 25276546 - 25276486
Alignment:
| Q |
279 |
ttctatcttttaattagttgaacgatggttttttcattcgccgacaaaggttagacctttc |
339 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||| ||||||| ||| | |||||| |
|
|
| T |
25276546 |
ttctatattttaattagtcgaacgatggttttttcattcctcgacaaatgttcgtcctttc |
25276486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University