View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309A_low_96 (Length: 333)
Name: NF11309A_low_96
Description: NF11309A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309A_low_96 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 13 - 311
Target Start/End: Original strand, 38624185 - 38624483
Alignment:
| Q |
13 |
aatattctataaccatatcccaagcagagttgtgctagcaacattcaatctaacactttctttttaacatttactttttatgaagttgaaatatttgcaa |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38624185 |
aatactctataaccatatcccaagcagagttgtgccagcaacattcaatctaacactttctttttaacatttactttttatgaagttgaaatatttgcaa |
38624284 |
T |
|
| Q |
113 |
gactttatgtttctccattttcaaaatggtttaacctacatattttccacttaatgagtgagtgctaagaaagaaattattagaatgagtgttgccagca |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38624285 |
gactttatgtttttccattttcaaaatggtttaacctacatattttccacttaatgagtgagtgctaagaaagaaattattagaatgagtgttgccagca |
38624384 |
T |
|
| Q |
213 |
ctcgattattttgaagcgcggatatgttttgacgggtatgcttattataatttatagacaacctccatgagagtgttcttacaaactcagactaatagt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38624385 |
ctcgattattttgaagcgcggatatgttttgacgggtatgcttattataatttatagacaacctccatgagagtgttcttacaaactcagactaatagt |
38624483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University