View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309_high_22 (Length: 336)
Name: NF11309_high_22
Description: NF11309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 37550075 - 37550301
Alignment:
| Q |
1 |
aaaaggaggagtaggagagttgaaattcggcggcggaaaagaaccacaagattgatcggagcatttgttgtcgtggtgacggcgtaagacgccaaatcct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37550075 |
aaaaggaggagtaggagagttgaaattcggcggcggaaaagaaccgcaagattgatcggagcatttgttgttgtggtgacggcgtaagacgccaaatcct |
37550174 |
T |
 |
| Q |
101 |
aagatgagaccagtaataacgagagcagtgacgatgaagatgaagatctttgttgcttttcccacgtagcacatttctctgaacttgtttaagatttgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37550175 |
aagatgagaccagtaataacgagagcagtgacgatgaagatgaagatctttgttgcttttcccacgtagcacatttctctgaacttgtttaagatttgtg |
37550274 |
T |
 |
| Q |
201 |
ttgttgatggtggggcaatgttctgaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
37550275 |
ttgttgatggtggggcaatgttctgaa |
37550301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University