View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309_high_26 (Length: 278)
Name: NF11309_high_26
Description: NF11309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309_high_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 146 - 269
Target Start/End: Original strand, 37549996 - 37550119
Alignment:
| Q |
146 |
ttggatttgtaatcagtggtggagattgtgattctgccggaggattaggtggattgctactgacagggttgttaagagtaaaaggaggagtaggagaatt |
245 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37549996 |
ttggatttgtaatcactggtggagattgtgattctgccggaggattaggtggattactactgacagggttgttaagagtaaaaggaggagtaggagagtt |
37550095 |
T |
 |
| Q |
246 |
gaaattcggctgcggaaaagaacc |
269 |
Q |
| |
|
|||||||||| ||||||||||||| |
|
|
| T |
37550096 |
gaaattcggcggcggaaaagaacc |
37550119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 37549869 - 37549916
Alignment:
| Q |
19 |
gtaggcgtactaggcggctccgccacactcggcggtgattgcaccaac |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37549869 |
gtaggcgtactaggcggctccgccacactcggcggtgattgcaccaac |
37549916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University