View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309_high_36 (Length: 231)
Name: NF11309_high_36
Description: NF11309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309_high_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 11 - 228
Target Start/End: Original strand, 33900065 - 33900282
Alignment:
| Q |
11 |
catagggggcatgacttgtacttcttgctcctctaacgtgcaatcagttcttcaatcccttcaaggggtgcaaatagcacaagtggccttggcaactgaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33900065 |
catagggggcatgacttgtacttcttgctcctccaacgtgcaatcagttcttcaatcccttcgtggggtgcaaatagcacaagtggccttggcaactgaa |
33900164 |
T |
|
| Q |
111 |
gaagcagaaattcgttatgatccaaagattataagctacactcaactaatggaaactatatcaaacacaggttttaatcccatattaataagcaaagggg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33900165 |
gaagcagaaattcgttatgatccaaagattataagctacactcaactaatggaaactatatcaaacacaggttttaatcccatattaataagcaaagggg |
33900264 |
T |
|
| Q |
211 |
aacaaataagcaaaattg |
228 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
33900265 |
aacacataagcaaaattg |
33900282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University