View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309_low_17 (Length: 394)
Name: NF11309_low_17
Description: NF11309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309_low_17 |
 |  |
|
| [»] chr5 (155 HSPs) |
 |  |
|
| [»] chr8 (150 HSPs) |
 |  |
|
| [»] chr7 (163 HSPs) |
 |  |
|
| [»] chr6 (99 HSPs) |
 |  |
|
| [»] chr3 (173 HSPs) |
 |  |
|
| [»] scaffold0864 (2 HSPs) |
 |  |
|
| [»] chr1 (167 HSPs) |
 |  |
|
| [»] scaffold0594 (2 HSPs) |
 |  |
|
| [»] scaffold0035 (2 HSPs) |
 |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |
|
| [»] scaffold0922 (1 HSPs) |
 |  |
|
| [»] scaffold0606 (1 HSPs) |
 |  |
|
| [»] scaffold0474 (2 HSPs) |
 |  |
|
| [»] scaffold0370 (4 HSPs) |
 |  |
|
| [»] scaffold0122 (2 HSPs) |
 |  |
|
| [»] scaffold0005 (2 HSPs) |
 |  |
|
| [»] chr2 (121 HSPs) |
 |  |
|
| [»] scaffold0022 (2 HSPs) |
 |  |
|
| [»] scaffold0014 (3 HSPs) |
 |  |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |
|
| [»] scaffold0777 (1 HSPs) |
 |  |
|
| [»] scaffold0352 (2 HSPs) |
 |  |
|
| [»] scaffold0328 (1 HSPs) |
 |  |
|
| [»] scaffold0213 (2 HSPs) |
 |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |
|
| [»] scaffold1171 (1 HSPs) |
 |  |  |
|
| [»] scaffold0951 (1 HSPs) |
 |  |  |
|
| [»] scaffold0283 (2 HSPs) |
 |  |
|
| [»] scaffold0182 (3 HSPs) |
 |  |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |
|
| [»] scaffold0693 (1 HSPs) |
 |  |  |
|
| [»] scaffold0592 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |
|
| [»] scaffold0272 (4 HSPs) |
 |  |
|
| [»] scaffold0227 (1 HSPs) |
 |  |
|
| [»] scaffold0250 (1 HSPs) |
 |  |  |
|
| [»] scaffold1067 (2 HSPs) |
 |  |
|
| [»] scaffold0154 (2 HSPs) |
 |  |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 171)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 17 - 338
Target Start/End: Original strand, 38976578 - 38976897
Alignment:
| Q |
17 |
agaaagagtaggaaaggatggaaattatgtccatggttcttgatgttgttttatcttgtgattctcaaatgcttatataatagttttgtttatatgacta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38976578 |
agaaagagtaggaaaggatggaaattatgtccatggttcttgatgttgttttatcttgtgattctcaaatgcttatataatagttttgttcatatgacta |
38976677 |
T |
 |
| Q |
117 |
gtcaccttgcatggtgcgagccatgcaatatttcttttggtgatgaaattgtgtatgacattaccaatgactttggttcatacaaacaaattaggggaaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38976678 |
gtcaccttgcatggtgcgagccatgcaatatttcttttgctgatgaaattgtgtatgtcattaccaatgactttggttcat----acaaattaggggaaa |
38976773 |
T |
 |
| Q |
217 |
ttaatataatttaattgtatctgtactgtacaccgactttttaacctattagcttg-nnnnnnnnnatataaaattatttgttgtcaatttcattgcatc |
315 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38976774 |
ttaatttaatttaattgtatctgtactgtacacagactttttaacctattagcttgttttttttttatataaaattatttgttgtcaatttcattgcatc |
38976873 |
T |
 |
| Q |
316 |
atcgttatataa-tgaatttaaaa |
338 |
Q |
| |
|
|||||||||||| ||||||||||| |
|
|
| T |
38976874 |
atcgttatataattgaatttaaaa |
38976897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 52046033 - 52045974
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52046033 |
aaaaggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
52045974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 7666510 - 7666456
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7666510 |
gcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
7666456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 29548492 - 29548438
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29548492 |
gcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
29548438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 11529755 - 11529814
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11529755 |
aaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11529814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 20474028 - 20473969
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20474028 |
aaaaggcttaattgcacttttagacccctatctttccaaaagttgcggttatggacccct |
20473969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 41205813 - 41205754
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41205813 |
aaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
41205754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 104201 - 104255
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
104201 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
104255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 11159732 - 11159678
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11159732 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11159678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 332 - 394
Target Start/End: Complemental strand, 11530080 - 11530018
Alignment:
| Q |
332 |
tttaaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
11530080 |
tttaaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
11530018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 14578752 - 14578698
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14578752 |
gcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
14578698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 17262397 - 17262343
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17262397 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
17262343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 22160140 - 22160086
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22160140 |
gcttaattgcacttttagacccctatctttccaaaagttgcggttatggacccct |
22160086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 23315690 - 23315636
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23315690 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
23315636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 24415386 - 24415332
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24415386 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
24415332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 27246860 - 27246914
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27246860 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27246914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 37289456 - 37289510
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37289456 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
37289510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 38371272 - 38371326
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38371272 |
gcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
38371326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 39946389 - 39946335
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39946389 |
gcttaattgcacttttggacccttatctttccaaaagttgtggttatggacccct |
39946335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 41205499 - 41205553
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41205499 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
41205553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 42672380 - 42672326
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42672380 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42672326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 50996036 - 50996090
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50996036 |
gcttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
50996090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 51537431 - 51537485
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
51537431 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
51537485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 52045722 - 52045776
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52045722 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52045776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 52310802 - 52310856
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52310802 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52310856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 52311114 - 52311060
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52311114 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52311060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 340 - 393
Target Start/End: Complemental strand, 31844099 - 31844046
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccc |
393 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31844099 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccc |
31844046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 7705591 - 7705643
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7705591 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
7705643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 12641131 - 12641079
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12641131 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
12641079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 27751474 - 27751422
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27751474 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27751422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 34957667 - 34957615
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34957667 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
34957615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 7666196 - 7666255
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
7666196 |
aaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
7666255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 339 - 394
Target Start/End: Original strand, 19693017 - 19693072
Alignment:
| Q |
339 |
tgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
19693017 |
tgcttaattgcacttttggacccctaactttccaaaagttgtggttacggacccct |
19693072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 339 - 394
Target Start/End: Original strand, 19703602 - 19703657
Alignment:
| Q |
339 |
tgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
19703602 |
tgcttaattgcacttttggacccctaactttccaaaagttgtggttacggacccct |
19703657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 340 - 387
Target Start/End: Complemental strand, 43822010 - 43821963
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43822010 |
gcttaattgcacttttggacccctatctttccaaaagttgtggttatg |
43821963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 335 - 390
Target Start/End: Original strand, 51696532 - 51696587
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
51696532 |
aaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
51696587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 104512 - 104458
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
104512 |
gcttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
104458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 233003 - 232949
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
233003 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
232949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 1377606 - 1377660
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1377606 |
gcttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
1377660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 4902468 - 4902414
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
4902468 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
4902414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 5344583 - 5344529
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
5344583 |
gcttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
5344529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 6386732 - 6386786
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6386732 |
gcttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
6386786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 7644458 - 7644512
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
7644458 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
7644512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 7705901 - 7705847
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| |||||||||||||| |
|
|
| T |
7705901 |
gcttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
7705847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 8891965 - 8891911
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8891965 |
gcttaattgcactttaggacccctatcttttcaaaagttgtggttatggacccct |
8891911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 13021291 - 13021237
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
13021291 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
13021237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 13607918 - 13607972
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13607918 |
gcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
13607972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 14578439 - 14578493
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
14578439 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatgtacccct |
14578493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 18988180 - 18988234
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
18988180 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
18988234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 342 - 388
Target Start/End: Complemental strand, 19869468 - 19869422
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19869468 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatgg |
19869422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 20472858 - 20472804
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20472858 |
gcttaattgtacttttggacccctatctttccaaaagttgcggttatggacccct |
20472804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 21536881 - 21536935
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
21536881 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggaaccct |
21536935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 26675054 - 26675108
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26675054 |
gcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
26675108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 27247171 - 27247117
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
27247171 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
27247117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 27751164 - 27751218
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
27751164 |
gcttaattgcacttttggacctctatgtttccaaaagttgtggttatggacccct |
27751218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 336 - 394
Target Start/End: Original strand, 31209221 - 31209279
Alignment:
| Q |
336 |
aaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||| |||||| ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
31209221 |
aaatgcttaattggacttttggacccatatctttccaaaagttgcggttatggacccct |
31209279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 336 - 394
Target Start/End: Complemental strand, 31209534 - 31209476
Alignment:
| Q |
336 |
aaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| ||||||||| |||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31209534 |
aaatgtttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
31209476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 31250781 - 31250727
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
31250781 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
31250727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 34362821 - 34362875
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
34362821 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34362875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 35364507 - 35364453
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
35364507 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
35364453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 45289812 - 45289758
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
45289812 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45289758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 47854292 - 47854238
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
47854292 |
gcttaattgcacttttggacccctatatttccaaaagttgcggttatggacccct |
47854238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 48278228 - 48278174
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
48278228 |
gcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
48278174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 51696841 - 51696787
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
51696841 |
gcttaatagcacttttggacccctatctttccaaaagttgcggttatggacccct |
51696787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 52114446 - 52114392
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| |||||||||||||| |
|
|
| T |
52114446 |
gcttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
52114392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 54215957 - 54216011
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
54215957 |
gcttaattgcacttttggacccctatctttccgaaagttgcggttatggacccct |
54216011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 55586929 - 55586875
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
55586929 |
gcttaattgcacttttggacccctatctttccgaaagttgcggttatggacccct |
55586875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 6769107 - 6769054
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||| ||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6769107 |
cttaattacacttttggacccctatcttttcaaaagttgtggttatggacccct |
6769054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 8891656 - 8891709
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
8891656 |
cttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
8891709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 342 - 391
Target Start/End: Original strand, 17554048 - 17554097
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17554048 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
17554097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 342 - 391
Target Start/End: Original strand, 20472552 - 20472601
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
20472552 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
20472601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 23419645 - 23419592
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23419645 |
cttaattgcacttttggacccctatctttttaaaagttgtggttatggacccct |
23419592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 41707720 - 41707773
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
41707720 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
41707773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 340 - 393
Target Start/End: Original strand, 48277917 - 48277970
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccc |
393 |
Q |
| |
|
||||||||||| |||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48277917 |
gcttaattgcatttttggacccctatcttttcaaaagttgtggttatggacccc |
48277970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 50513353 - 50513300
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
50513353 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
50513300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 388
Target Start/End: Original strand, 13019274 - 13019322
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
13019274 |
gcttaattgcacttttggacccctatcttttcaaaagttgtggttatgg |
13019322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 30998494 - 30998442
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
30998494 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
30998442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 39136299 - 39136351
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
39136299 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggaccc |
39136351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 39136609 - 39136557
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| | |||||||||||| |
|
|
| T |
39136609 |
gcttaattgcacttttggacccctatctttccaaaagtagcggttatggaccc |
39136557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 388
Target Start/End: Original strand, 43821720 - 43821768
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
43821720 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
43821768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 387
Target Start/End: Original strand, 7396142 - 7396189
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
7396142 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
7396189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 391
Target Start/End: Original strand, 12640821 - 12640872
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
12640821 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacc |
12640872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 339 - 394
Target Start/End: Original strand, 22159829 - 22159884
Alignment:
| Q |
339 |
tgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
22159829 |
tgcttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
22159884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 391
Target Start/End: Original strand, 54556615 - 54556666
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
54556615 |
gcttaattgcacttttggacccctatttttccaaaagttgcggttatggacc |
54556666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 4902137 - 4902191
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
4902137 |
gcttaattgcacttttggacccctatctttccaaaagttgctgttatggccccct |
4902191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 7119595 - 7119649
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||||| || |||||||||||||||||||| |||||||||||||| |
|
|
| T |
7119595 |
gcttaattgtacttttggatccctatctttccaaaagttgcggttatggacccct |
7119649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 7644771 - 7644717
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
7644771 |
gcttaattgcacttttgaacccctatctttctaaaagttgcggttatggacccct |
7644717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 17554358 - 17554304
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| | |||||||||||| |
|
|
| T |
17554358 |
gcttaattgcacttttggacccctatcttttcaaaagttgcgattatggacccct |
17554304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 20466386 - 20466440
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
20466386 |
gcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
20466440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 342 - 388
Target Start/End: Complemental strand, 23770077 - 23770031
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
23770077 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
23770031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 24415074 - 24415128
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
24415074 |
gcttaattgcacttttggacccctatctttccaaaagttgcagttatggatccct |
24415128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 24542755 - 24542809
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
24542755 |
gcttaattgcacttttggacccctatcttttcaaaagttacggttatggacccct |
24542809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 26675367 - 26675314
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
26675367 |
gcttaattgcacttttggaccc-tatctttccaaaagttgcggttatggacccct |
26675314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 29548181 - 29548235
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |||||| ||||||| |
|
|
| T |
29548181 |
gcttaattgcacttttggacccttatctttccaaaagttgcggttatagacccct |
29548235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 29627919 - 29627865
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| ||||| |||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29627919 |
gcttagttgcatttttggacccctatctttccaaaagttgcggttatggacccct |
29627865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 30998184 - 30998238
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||| ||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
30998184 |
gcttaactgcacttttagacctctatctttccaaaagttgcggttatggacccct |
30998238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 34363130 - 34363076
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
34363130 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatgggcccct |
34363076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 35364197 - 35364251
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
35364197 |
gcttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
35364251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 37289768 - 37289714
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
37289768 |
gcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
37289714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 44921922 - 44921868
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
44921922 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
44921868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 45289501 - 45289555
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||| ||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
45289501 |
gcttaaatgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45289555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 47821476 - 47821530
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
47821476 |
gcttaattgcacttttggacccctatctttcaaaaagttgcggttatggccccct |
47821530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 390
Target Start/End: Original strand, 47853977 - 47854027
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||| |
|
|
| T |
47853977 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
47854027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 346 - 392
Target Start/End: Complemental strand, 51537737 - 51537691
Alignment:
| Q |
346 |
ttgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51537737 |
ttgcacttttggacccctatctttccaaaagttgcggttatggaccc |
51537691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 51537928 - 51537874
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
51537928 |
gcttaatttcacttttggacccctatctttccaaaagttgcggttatgaacccct |
51537874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 54556927 - 54556873
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
54556927 |
gcttaattgcacttttggacctctatctttctaaaagttgcggttatggacccct |
54556873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 55586617 - 55586671
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
55586617 |
gcttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
55586671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 341 - 387
Target Start/End: Original strand, 56296619 - 56296665
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
56296619 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatg |
56296665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 340 - 393
Target Start/End: Original strand, 8482860 - 8482913
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccc |
393 |
Q |
| |
|
|||||||||||||||| ||||||||| ||| ||||||||| ||||||||||||| |
|
|
| T |
8482860 |
gcttaattgcacttttggacccctattttttcaaaagttgcggttatggacccc |
8482913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 5344271 - 5344323
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||| ||||| |
|
|
| T |
5344271 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatagaccc |
5344323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 6768800 - 6768852
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
6768800 |
ttaattgcacttttggacccttatctttctaaaagttgcggttatggacccct |
6768852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 340 - 388
Target Start/End: Complemental strand, 10046248 - 10046200
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||| |
|
|
| T |
10046248 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatgg |
10046200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 390
Target Start/End: Original strand, 31843790 - 31843838
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||| ||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
31843790 |
ttaattacacttttggacccctatcttttcaaaagttgtggttatggac |
31843838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 34158474 - 34158526
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
34158474 |
ttaattgcatttttggacccctatctttccaaaaattgcggttatggacccct |
34158526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 37973516 - 37973568
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |||||| ||||||| |
|
|
| T |
37973516 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatagacccct |
37973568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 6387045 - 6386990
Alignment:
| Q |
340 |
gcttaattgcactttttgacccc-tatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
6387045 |
gcttaattgcacttttggaccccctatctttctaaaagttgcggttatggacccct |
6386990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 342 - 389
Target Start/End: Original strand, 31250481 - 31250528
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatgga |
389 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
31250481 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatgga |
31250528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 387
Target Start/End: Complemental strand, 47821635 - 47821588
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||| ||||||| |
|
|
| T |
47821635 |
gcttaattgcacttttagacccctatctttccgaaagttgcggttatg |
47821588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 390
Target Start/End: Complemental strand, 7119906 - 7119856
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||| |||||||||| |
|
|
| T |
7119906 |
gcttaattgcacttttggatccctatcttttcaaaagttgcggttatggac |
7119856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 10045957 - 10046010
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
10045957 |
gcttaattgcacttttggacccctatctttcc-aaagttgcggttatggccccct |
10046010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 17262091 - 17262145
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||| || |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
17262091 |
gcttaattgcactcttggaccactatcttttcaaaagttgcggttatggacccct |
17262145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 386
Target Start/End: Complemental strand, 17266059 - 17266013
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttat |
386 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
17266059 |
gcttaattgcacttttggacccctatctttctaaaagttgcggttat |
17266013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 18988492 - 18988438
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| || ||||||||||| |
|
|
| T |
18988492 |
gcttaattgcacttttggacccctatctttttaaaagttgcggctatggacccct |
18988438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 23769805 - 23769859
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||| ||| ||||||||||||||||| ||||| |
|
|
| T |
23769805 |
gcttaattgcacttttggacccctatttttttaaaagttgtggttatggccccct |
23769859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 26171242 - 26171296
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| ||||||||| ||||||||||||| |
|
|
| T |
26171242 |
gcttaattgcacttttggacccttatcttttcaaaagttgcagttatggacccct |
26171296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 29432359 - 29432305
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||| |||||||| |||||||||||||| |
|
|
| T |
29432359 |
gcttaattgcacttttggatccctatcttttcaaaagttacggttatggacccct |
29432305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 33338342 - 33338288
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||| ||| ||||| |
|
|
| T |
33338342 |
gcttaattgcacttttggacccctatctttctaaaagttgcggttctggccccct |
33338288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 334 - 388
Target Start/End: Complemental strand, 33508264 - 33508210
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
||||| |||||||| ||||||| ||||||||||||||||||||||| ||| |||| |
|
|
| T |
33508264 |
taaaaggcttaatttcacttttggacccctatctttccaaaagttgcggtaatgg |
33508210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 35083581 - 35083635
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| ||||||| |||||||||||||| |
|
|
| T |
35083581 |
gcttaattgcacttttgaacctctatctttccgaaagttggggttatggacccct |
35083635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 35083893 - 35083839
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||||||||| | |||||||||||| |
|
|
| T |
35083893 |
gcttaattgcacttttggacctctatcttttcaaaagttgcgattatggacccct |
35083839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 35835777 - 35835831
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||| || |||||||||||||| |
|
|
| T |
35835777 |
gcttaattgcacttttggacccctatcttttcaaaatttacggttatggacccct |
35835831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 37973827 - 37973773
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| |||||||||| ||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
37973827 |
gcttagttgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
37973773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 39332320 - 39332374
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
39332320 |
gcttaattgcatttttggacccctatcttttcaaaagttgcggttatggccccct |
39332374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 46282761 - 46282815
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
46282761 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggccccct |
46282815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 54216269 - 54216215
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
54216269 |
gcttaattgcacttttgaacctctatcttttcaaaagttgcggttatggacccct |
54216215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 385
Target Start/End: Original strand, 3065961 - 3066006
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggtta |
385 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||| ||||| |
|
|
| T |
3065961 |
gcttaattgcacttttggacccctaactttccaaaagttgcggtta |
3066006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 389
Target Start/End: Original strand, 17265850 - 17265899
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgga |
389 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
17265850 |
gcttaattgtacttttggacccctatctttctaaaagttgcggttatgga |
17265899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 342 - 387
Target Start/End: Original strand, 18994670 - 18994715
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
18994670 |
ttaattgcacttttggacccctatctttcgaaaagttgcggttatg |
18994715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 357 - 394
Target Start/End: Complemental strand, 20466680 - 20466643
Alignment:
| Q |
357 |
gacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20466680 |
gacccctatctttccaaaagttgcggttatggacccct |
20466643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 342 - 391
Target Start/End: Complemental strand, 34158783 - 34158734
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||| || |||||||||| ||||||||| ||||||||||| |
|
|
| T |
34158783 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggacc |
34158734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 341 - 386
Target Start/End: Complemental strand, 37432529 - 37432484
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttat |
386 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| |||||| |
|
|
| T |
37432529 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttat |
37432484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 393
Target Start/End: Original strand, 39946081 - 39946134
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccc |
393 |
Q |
| |
|
|||||||||||||||| |||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
39946081 |
gcttaattgcacttttggaccattatctttctaaaagttgcggttatggacccc |
39946134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 341 - 386
Target Start/End: Original strand, 42672070 - 42672115
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttat |
386 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
42672070 |
cttaattgcacttttggacccctatctttcaaaaagttgcggttat |
42672115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 24543053 - 24543001
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||||||| |||| |
|
|
| T |
24543053 |
ttaattgcacttttggacccctatcttttcaaaagttgcagttatggatccct |
24543001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 28158899 - 28158951
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| || |||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
28158899 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggatccct |
28158951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 29432050 - 29432102
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||| |||| || |||||| |
|
|
| T |
29432050 |
ttaattgcacttttggacccctatctttccaaaaattgcggttgtgaacccct |
29432102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 340 - 388
Target Start/End: Original strand, 41787050 - 41787098
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||| ||| |||||||| |
|
|
| T |
41787050 |
gcttaattgcacttttggacccctatctttcaaaaaattgcggttatgg |
41787098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 379
Target Start/End: Complemental strand, 2016741 - 2016702
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
2016741 |
gcttaattgcactttttgcccactatctttccaaaagttg |
2016702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 387
Target Start/End: Complemental strand, 3770472 - 3770425
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||||||||| ||||||| |
|
|
| T |
3770472 |
gcttaattgcacttttggacctctatcttttcaaaagttgcggttatg |
3770425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 387
Target Start/End: Complemental strand, 18995115 - 18995068
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
||||||||| | |||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
18995115 |
gcttaattgtatttttggacccctatctttccaaaagttgcggttatg |
18995068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 379
Target Start/End: Complemental strand, 21537189 - 21537150
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
21537189 |
gcttaattgcacttttggacccctatcttttcaaaagttg |
21537150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 347 - 394
Target Start/End: Original strand, 28981921 - 28981968
Alignment:
| Q |
347 |
tgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
28981921 |
tgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
28981968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 379
Target Start/End: Complemental strand, 36414020 - 36413981
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
36414020 |
gcttaattgcacttttggccccctatctttccaaaagttg |
36413981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 379
Target Start/End: Original strand, 44822440 - 44822479
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
44822440 |
gcttaattgcacctttggacccctatctttccaaaagttg |
44822479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 3770180 - 3770234
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||| | |||||| ||||| |
|
|
| T |
3770180 |
gcttaattgcacttttggacccctatctttcttaaagttgcgattatggccccct |
3770234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 8483172 - 8483118
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||| ||| ||||||||| |||||| ||||||| |
|
|
| T |
8483172 |
gcttaattgcacttttggacctctattttttcaaaagttgcggttatagacccct |
8483118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 34957379 - 34957432
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || || ||||||| ||||||||| |||||||||||||| |
|
|
| T |
34957379 |
gcttaattgcacttttggatcc-tatcttttcaaaagttgcggttatggacccct |
34957432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 38371576 - 38371522
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||| |||||||| |||| |||||||| ||||| ||| |||||||||||||| |
|
|
| T |
38371576 |
gcttaatcgcacttttggacctctatcttttcaaaaattgcggttatggacccct |
38371522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 50513046 - 50513100
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| ||||||||| |||||||| |||| |
|
|
| T |
50513046 |
gcttaattgcacttttggactcctatcttttcaaaagttgcagttatggatccct |
50513100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 340 - 385
Target Start/End: Complemental strand, 3066839 - 3066794
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggtta |
385 |
Q |
| |
|
|||||||||||||||| ||||| || |||||||||||||| ||||| |
|
|
| T |
3066839 |
gcttaattgcacttttggacccataactttccaaaagttgcggtta |
3066794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 340 - 393
Target Start/End: Complemental strand, 17221614 - 17221561
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccc |
393 |
Q |
| |
|
||||||||| |||||| || || ||||||| ||||||||| ||||||||||||| |
|
|
| T |
17221614 |
gcttaattgtacttttggatccttatcttttcaaaagttgcggttatggacccc |
17221561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 340 - 377
Target Start/End: Original strand, 19725660 - 19725697
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagt |
377 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
19725660 |
gcttaattgcacttttggccccctatctttccaaaagt |
19725697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 26171551 - 26171498
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| |||| |||||||| |||||||| ||||||||| |||| |
|
|
| T |
26171551 |
cttaattgcacttttggacctctatcttttcaaaagttacggttatggatccct |
26171498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 342 - 379
Target Start/End: Complemental strand, 28291964 - 28291927
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
28291964 |
ttaattgcacttttagccccctatctttccaaaagttg |
28291927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 338 - 379
Target Start/End: Original strand, 40489210 - 40489251
Alignment:
| Q |
338 |
atgcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| |||||||| |
|
|
| T |
40489210 |
atgcttaattgcacttttagccccctatctttctaaaagttg |
40489251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 4107508 - 4107560
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||| ||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
4107508 |
ttaattgcatttttggacccctatcttttcaaaagttacagttatggacccct |
4107560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 331 - 379
Target Start/End: Original strand, 24886524 - 24886572
Alignment:
| Q |
331 |
atttaaaatgcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||| | |||||||||||||||| | ||||||||||| ||||||||| |
|
|
| T |
24886524 |
atttaataggcttaattgcacttttggtcccctatcttttcaaaagttg |
24886572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 28982222 - 28982170
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||| ||| ||| ||||||||| |||||||||||||| |
|
|
| T |
28982222 |
ttaattgcacttttggacctatattttttcaaaagttgcggttatggacccct |
28982170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 340 - 388
Target Start/End: Complemental strand, 39332610 - 39332562
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||| |||||||| |
|
|
| T |
39332610 |
gcttaattgcacttttgaacccctatctttttaaaagttgcggttatgg |
39332562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 44921617 - 44921669
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||| ||||||| |||||||| ||||||||| |||| |
|
|
| T |
44921617 |
ttaattgcacttttggacccttatctttttaaaagttgcggttatggatccct |
44921669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 56296908 - 56296856
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| || | ||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
56296908 |
ttaattgcatttctggacccctatcttttcaaaagttgcggttatggtcccct |
56296856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 1e-20; HSPs: 155)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 12049115 - 12049174
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12049115 |
aaaaggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
12049174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 28620040 - 28620094
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28620040 |
gcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
28620094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 4125440 - 4125499
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4125440 |
aaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
4125499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 339 - 394
Target Start/End: Complemental strand, 31172877 - 31172822
Alignment:
| Q |
339 |
tgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31172877 |
tgcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
31172822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 339 - 394
Target Start/End: Complemental strand, 41880350 - 41880295
Alignment:
| Q |
339 |
tgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41880350 |
tgcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
41880295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 223206 - 223152
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
223206 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
223152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 2710341 - 2710395
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2710341 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
2710395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 5088384 - 5088330
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5088384 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
5088330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 11480037 - 11480091
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11480037 |
gcttaattgcacttttggacccctatctttccaaaagttgaggttatggacccct |
11480091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 15526705 - 15526759
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15526705 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
15526759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 16521155 - 16521209
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16521155 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
16521209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 25631087 - 25631141
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25631087 |
gcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
25631141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 27264110 - 27264164
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27264110 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27264164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 28394934 - 28394988
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28394934 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
28394988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 29401401 - 29401347
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29401401 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
29401347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 40297666 - 40297720
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40297666 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
40297720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 40768200 - 40768146
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40768200 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
40768146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 20974462 - 20974515
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20974462 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
20974515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 28395244 - 28395191
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28395244 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
28395191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 27264415 - 27264363
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27264415 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27264363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 29183136 - 29183188
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29183136 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
29183188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 30894126 - 30894178
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30894126 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
30894178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 23263141 - 23263200
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
23263141 |
aaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
23263200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 342 - 393
Target Start/End: Complemental strand, 25566852 - 25566801
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccc |
393 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25566852 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccc |
25566801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 28736757 - 28736698
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
28736757 |
aaaaggcttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
28736698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 34606687 - 34606628
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
34606687 |
aaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34606628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 2710649 - 2710595
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
2710649 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
2710595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 3020906 - 3020852
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
3020906 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
3020852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 3223596 - 3223542
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
3223596 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
3223542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 4125756 - 4125702
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
4125756 |
gcttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
4125702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 5088075 - 5088129
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5088075 |
gcttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
5088129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 8339960 - 8340014
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
8339960 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
8340014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 13356558 - 13356612
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13356558 |
gcttgattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
13356612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 13765260 - 13765314
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
13765260 |
gcttaattgcacttttcgacccctatcttttcaaaagttgcggttatggacccct |
13765314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 15738075 - 15738129
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
15738075 |
gcttaattgcactttttgacccctatcttttcaaaagttgcggttatggatccct |
15738129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 390
Target Start/End: Complemental strand, 16666885 - 16666835
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
16666885 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
16666835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 18266353 - 18266407
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
18266353 |
gcttaattgcacttttggacccctatctttccaaaggttgcggttatggacccct |
18266407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 20974721 - 20974667
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
20974721 |
gcttaattgtacttttggacccctatcttttcaaaagttgtggttatggacccct |
20974667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 22052440 - 22052494
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22052440 |
gcttaattgcacttttggccccctatctttccaaaagttgcggttatggacccct |
22052494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 22052751 - 22052697
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22052751 |
gcttaattgcaattttggacccctatctttccaaaagttgcggttatggacccct |
22052697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 23103924 - 23103978
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23103924 |
gcttaattacacttttggacccctatctttccaaaagttgcggttatggacccct |
23103978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 26323687 - 26323633
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
26323687 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
26323633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 34169100 - 34169046
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
34169100 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34169046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 34734385 - 34734331
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
34734385 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34734331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 35306711 - 35306765
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
35306711 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
35306765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 35307014 - 35306960
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
35307014 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
35306960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 40687667 - 40687721
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
40687667 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
40687721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 43586098 - 43586044
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
43586098 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
43586044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 16329890 - 16329837
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| || |||||||||| |||||||||||||||||||||||| |
|
|
| T |
16329890 |
cttaattgcacttttggatccctatcttttcaaaagttgtggttatggacccct |
16329837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 28251400 - 28251453
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
28251400 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
28251453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 40767890 - 40767943
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
40767890 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
40767943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 344 - 392
Target Start/End: Original strand, 1050041 - 1050089
Alignment:
| Q |
344 |
aattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1050041 |
aattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
1050089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 8755323 - 8755271
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
8755323 |
ttaattgcacttttggacccctattttttcaaaagttgtggttatggacccct |
8755271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 13960691 - 13960743
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
13960691 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
13960743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 19849555 - 19849607
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
19849555 |
ttaattgcacttttggacccctatctttcaaaaagttgcggttatggacccct |
19849607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 26151797 - 26151849
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
26151797 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
26151849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 28736443 - 28736495
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
28736443 |
ttaattgcacttttggacccctatttttccaaaagttgcggttatggacccct |
28736495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 33825603 - 33825655
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33825603 |
ttaattgcacgtttggacccctatctttccaaaagttgcggttatggacccct |
33825655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 40297976 - 40297924
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||| |||||||||||||| |
|
|
| T |
40297976 |
ttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
40297924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 2546367 - 2546426
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
2546367 |
aaaaagcttaattgcacttttggacccctatctttccaaaagttacggttatgaacccct |
2546426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 330 - 393
Target Start/End: Complemental strand, 8340282 - 8340219
Alignment:
| Q |
330 |
aatttaaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccc |
393 |
Q |
| |
|
||||||||| |||||||| ||||||| ||||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
8340282 |
aatttaaaaggcttaattccacttttggacccctatcttttcaaaagttgcgcttatggacccc |
8340219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 387
Target Start/End: Original strand, 9071969 - 9072016
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
9071969 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
9072016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 9072266 - 9072207
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
9072266 |
aaaaggcttaattgcacttttggacccttatctttccaaaagttgcggttatggccccct |
9072207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 13356862 - 13356807
Alignment:
| Q |
340 |
gcttaattgcactttttga-cccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13356862 |
gcttaattgcacttttggatcccctatctttccaaaagttgcggttatggacccct |
13356807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 14647692 - 14647751
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
14647692 |
aaaaggcttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
14647751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 15738390 - 15738331
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
15738390 |
aaaaggcttaattgcacttttggacccatatcttttcaaaagttgcggttatggacccct |
15738331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 30894433 - 30894374
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| ||||||||||| |||| || |||||||||| |||||||||||||||||||||||| |
|
|
| T |
30894433 |
aaaaggcttaattgcatttttggatccctatcttttcaaaagttgtggttatggacccct |
30894374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 35055777 - 35055832
Alignment:
| Q |
340 |
gcttaattgcactttttga-cccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35055777 |
gcttaattgcacttttggatcccctatctttccaaaagttgcggttatggacccct |
35055832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 1055680 - 1055626
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||||| ||||||| |
|
|
| T |
1055680 |
gcttaattgcacttttggacccctatctttctaaaagttgcggttatagacccct |
1055626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 3020595 - 3020649
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||| ||| ||||||||| |||||||||||||| |
|
|
| T |
3020595 |
gcttaattgcacttttggacccctattttttcaaaagttgcggttatggacccct |
3020649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 342 - 388
Target Start/End: Complemental strand, 5891790 - 5891744
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
5891790 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
5891744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 7219809 - 7219755
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| | ||||||||||||||||| |||||||||||||| |
|
|
| T |
7219809 |
gcttaattgcacttttggactcttatctttccaaaagttgcggttatggacccct |
7219755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 8986611 - 8986665
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
8986611 |
gcttaattgcacttttggactcctatctttccaaaagttacggttatggacccct |
8986665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 10029384 - 10029330
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
10029384 |
gcttaattgcacttttgaacccctatctttcgaaaagttgcggttatggacccct |
10029330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 12049429 - 12049375
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
12049429 |
gcttaattgcatttttggacccctatctttccaaaagttgcggttatagacccct |
12049375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 13170192 - 13170138
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
13170192 |
gcttaattgcacttttggacccttatctttctaaaagttgcggttatggacccct |
13170138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 13765573 - 13765519
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||| ||| |||||||||||||| |
|
|
| T |
13765573 |
gcttaattgcacttttggacccctatctttcaaaaaattgcggttatggacccct |
13765519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 16079490 - 16079436
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||| |||||||| ||||| |
|
|
| T |
16079490 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatggccccct |
16079436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 16666074 - 16666128
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
16666074 |
gcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
16666128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 19849855 - 19849801
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||| ||| |||||||||| |
|
|
| T |
19849855 |
gcttaattgcacttttggacccctatatttccaaaagttgcggtcatggacccct |
19849801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 390
Target Start/End: Complemental strand, 21583635 - 21583585
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||| |||||||||| |
|
|
| T |
21583635 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatggac |
21583585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 22773897 - 22773843
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
22773897 |
gcttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
22773843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 23263457 - 23263403
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||| ||||| |||||||||||||| |
|
|
| T |
23263457 |
gcttaattgcacttttggacctctatctttccaacagttgcggttatggacccct |
23263403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 23502440 - 23502386
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23502440 |
gcttaattgcacttttggacccctatctttccaaaagttgctattatggacccct |
23502386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 344 - 394
Target Start/End: Complemental strand, 26036524 - 26036474
Alignment:
| Q |
344 |
aattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
26036524 |
aattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
26036474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 26152104 - 26152050
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||||| ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
26152104 |
gcttaattgtacttttagacccatatctttccaaaagttgcggttatggacccct |
26152050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 31455883 - 31455937
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
31455883 |
gcttaattgcacttttggacccttatcttttcaaaagttgcggttatggacccct |
31455937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 31456173 - 31456119
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
31456173 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatgaacccct |
31456119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 34168790 - 34168840
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |||||||||||| |
|
|
| T |
34168790 |
ttaattgcacttttggacccctatctttcaaaaagttgcggttatggaccc |
34168840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 40687981 - 40687927
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
40687981 |
gcttaattgcacttttggacccctatcttttcaaaagttgcagttatggacccct |
40687927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 41140426 - 41140372
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
41140426 |
gcttaattgcacttttggacccctatctttctaaaagttgcggttatggccccct |
41140372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 42739528 - 42739582
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42739528 |
gcttaattgtacttttgaacccctatcttttcaaaagttgtggttatggacccct |
42739582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 333 - 391
Target Start/End: Original strand, 42947395 - 42947453
Alignment:
| Q |
333 |
ttaaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||||||||| |||||||| ||||||||||| |
|
|
| T |
42947395 |
ttaaaaggcttaattgcacttttggactcctatctttctaaaagttgcggttatggacc |
42947453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 342 - 391
Target Start/End: Original strand, 1055374 - 1055423
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
1055374 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacc |
1055423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 26323377 - 26323430
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26323377 |
cttatttgcactttgggacccctatctttccaaaagttggggttatggacccct |
26323430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 340 - 389
Target Start/End: Complemental strand, 39529077 - 39529028
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgga |
389 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
39529077 |
gcttaattacacttttggacccctatctttccaaaagttgcggttatgga |
39529028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 4096455 - 4096507
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| | |||||||||||| |
|
|
| T |
4096455 |
ttaattgcacttttggacccctatctttctaaaagttgcgtttatggacccct |
4096507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 7219499 - 7219551
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| ||||||||| ||| ||||||||| |||||||||||| |
|
|
| T |
7219499 |
gcttaattgcacttttggacccctattttttcaaaagttgcggttatggaccc |
7219551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 7623525 - 7623576
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
7623525 |
ttaattgcacttttggaccc-tatctttccaaaagttgcggttatggacccct |
7623576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 7623830 - 7623778
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
7623830 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
7623778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 8755016 - 8755068
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||| ||| ||||||||| |||||||||||||| |
|
|
| T |
8755016 |
ttaattgcacttttggacccctattttttcaaaagttgcggttatggacccct |
8755068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 16597044 - 16597096
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
16597044 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
16597096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 16859961 - 16860013
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
16859961 |
ttaattgcacttttggacccctatctttttaaaagttgtggttatggccccct |
16860013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 334 - 394
Target Start/End: Original strand, 20465498 - 20465558
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| |||||||| ||||||| ||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
20465498 |
taaaaggcttaattacacttttggacccctatctttccaaaagttgcagttatggccccct |
20465558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 22626988 - 22627040
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |||| |||||||| |
|
|
| T |
22626988 |
ttaattgcacttttggacctctatctttccaaaagttgtagttaaggacccct |
22627040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 340 - 388
Target Start/End: Original strand, 26036236 - 26036284
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| |||||||||||||||||| |
|
|
| T |
26036236 |
gcttaattgcacttttggacccatatcttttcaaaagttgtggttatgg |
26036284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 386
Target Start/End: Complemental strand, 28251688 - 28251644
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttat |
386 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
28251688 |
ttaattgcacttttggacccctatctttccaaaagttgcggttat |
28251644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 344 - 388
Target Start/End: Complemental strand, 28703957 - 28703913
Alignment:
| Q |
344 |
aattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
28703957 |
aattgcacttttggacccctatctttccaaaagttgcggttatgg |
28703913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 340 - 388
Target Start/End: Complemental strand, 32556057 - 32556009
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |||||||| |
|
|
| T |
32556057 |
gcttaattgcacttttggacccatatctttccaaaagttgcggttatgg |
32556009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 34082102 - 34082154
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| || |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
34082102 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
34082154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 34082413 - 34082361
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
34082413 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatgcaccc |
34082361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 35678095 - 35678147
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
35678095 |
ttaattgcatttttggacccctatctttccaaaagttgcgattatggacccct |
35678147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 340 - 388
Target Start/End: Complemental strand, 41032498 - 41032450
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| |||||||| |
|
|
| T |
41032498 |
gcttaattgcacttttggatccctatctttccaaaagttgcggttatgg |
41032450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 42779478 - 42779426
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| |||||||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
42779478 |
ttaatcgcacttttggacctctatctttccaaaaattgtggttatggacccct |
42779426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 391
Target Start/End: Original strand, 21583324 - 21583375
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||| ||||||||||| |
|
|
| T |
21583324 |
gcttaattgcactttgggacctctatctttccaaaagttgcggttatggacc |
21583375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 23104220 - 23104165
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatcttt-ccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| |||||||||| |||||||||||||| |
|
|
| T |
23104220 |
gcttaattgcacttttggacccttatcttttccaaaagttgcggttatggacccct |
23104165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 23695522 - 23695581
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||| ||| ||||| ||||||| |||||||||||||| |
|
|
| T |
23695522 |
aaaaggcttaattgcacttttggacccatatttttcccaaagttgcggttatggacccct |
23695581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 391
Target Start/End: Complemental strand, 29391326 - 29391275
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||||| ||| | ||||||||||||||||| ||||||||||| |
|
|
| T |
29391326 |
gcttaattgcacttttagactcttatctttccaaaagttgcggttatggacc |
29391275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 29401092 - 29401143
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||| |||| ||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
29401092 |
cttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
29401143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 343 - 394
Target Start/End: Original strand, 43585809 - 43585860
Alignment:
| Q |
343 |
taattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
43585809 |
taattgcacttttggacccctatctttctaaaagttgcggttatggccccct |
43585860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 3728285 - 3728339
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||||| |||| |||||||||||||||||| |||||||| ||||| |
|
|
| T |
3728285 |
gcttaattgtacttttggacctctatctttccaaaagttgcggttatggtcccct |
3728339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 4146450 - 4146396
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
4146450 |
gcttaattgcacttttggccccctatctttccaaaagttgtgattttggtcccct |
4146396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 14648000 - 14647946
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||||| ||||||||||||| ||||||| | |||||||||||||| |
|
|
| T |
14648000 |
gcttaattgtacttttggacccctatcttttcaaaagtcgcggttatggacccct |
14647946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 390
Target Start/End: Complemental strand, 16597352 - 16597302
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| |||||||||| |
|
|
| T |
16597352 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggac |
16597302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 16860118 - 16860064
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||| |||| |||||||| |||||||| ||||| |
|
|
| T |
16860118 |
gcttaattgcacttttggacccctatttttctaaaagttgcggttatggtcccct |
16860064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 39528767 - 39528821
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||| |||||||||||||| |
|
|
| T |
39528767 |
gcttaattgcacttttgaacccctatctttttaaaagttgcggttatggacccct |
39528821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 42739899 - 42739845
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| ||||||| |||||| |
|
|
| T |
42739899 |
gcttaattgcacttttggacccctatctttttaaaagttgcggttatgaacccct |
42739845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 334 - 391
Target Start/End: Original strand, 10029069 - 10029126
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
||||| |||||||| | |||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10029069 |
taaaaggcttaattacttttttggacccctatctttccaaaagttgcggttatggacc |
10029126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 393
Target Start/End: Original strand, 22925700 - 22925753
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccc |
393 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||| |||||| |||||| |
|
|
| T |
22925700 |
gcttaattgcacttttgaacctctatctttccaaaagttgcggttatagacccc |
22925753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 931848 - 931900
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
||||||||| |||||| || |||||||||| ||||||||| |||||||||||| |
|
|
| T |
931848 |
gcttaattgtacttttggatccctatcttttcaaaagttgcggttatggaccc |
931900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 335 - 391
Target Start/End: Complemental strand, 4096768 - 4096712
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||| |||||||||||||||| |||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
4096768 |
aaaaggcttaattgcacttttggacctttatcttttcaaaagttgcggttatggacc |
4096712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 390
Target Start/End: Complemental strand, 22925947 - 22925899
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||| || |||||| ||| |||||||||||||||||||| |
|
|
| T |
22925947 |
ttaattgcacttttggatccctattttttcaaaagttgtggttatggac |
22925899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 340 - 384
Target Start/End: Original strand, 34606374 - 34606418
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggtt |
384 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
34606374 |
gcttaattgcacttttaaacccctatctttccaaaagttgcggtt |
34606418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 3728581 - 3728522
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| || | ||||||||||||||||| |||||||| ||||| |
|
|
| T |
3728581 |
aaaaagcttaattgcacttttggatctctatctttccaaaagttacggttatggccccct |
3728522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 387
Target Start/End: Complemental strand, 9560146 - 9560099
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
||||||||||| |||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
9560146 |
gcttaattgcatttttggacccctatctttctaaaagttgcggttatg |
9560099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 391
Target Start/End: Complemental strand, 13961002 - 13960951
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
||||||||| |||||| |||| |||||||| ||||||||| ||||||||||| |
|
|
| T |
13961002 |
gcttaattgtacttttggacctctatcttttcaaaagttgcggttatggacc |
13960951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 344 - 387
Target Start/End: Original strand, 23499971 - 23500014
Alignment:
| Q |
344 |
aattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||| ||||||| |
|
|
| T |
23499971 |
aattgcacttttggacccctatcttttcaaaagttgcggttatg |
23500014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 379
Target Start/End: Complemental strand, 37060210 - 37060171
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
37060210 |
gcttaattgcacttttggccccctatctttccaaaagttg |
37060171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 37333850 - 37333791
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||| |||||||| |||||||| |||| ||| ||||| |
|
|
| T |
37333850 |
aaaaggcttaattgcacttttggacccttatctttctaaaagttgcggttttggtcccct |
37333791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 42779167 - 42779222
Alignment:
| Q |
340 |
gcttaattgcactttttga-cccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
42779167 |
gcttaattgcacttttggagcccctatctttttaaaagttgcggttatggacccct |
42779222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 2546684 - 2546630
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| |||||||| |||| |
|
|
| T |
2546684 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcagttatggatccct |
2546630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 3223437 - 3223491
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||| | ||||| ||| |||||||| ||||| |
|
|
| T |
3223437 |
gcttaattgcacttttggacccctatctattcaaaaattgcggttatggccccct |
3223491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 342 - 388
Target Start/End: Complemental strand, 21347742 - 21347696
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| |||||||| |
|
|
| T |
21347742 |
ttaattgcacttttggacccctatcttttcaaaagttacggttatgg |
21347696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 22627295 - 22627241
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||| ||| |||| ||||||||| |
|
|
| T |
22627295 |
gcttaattgcacttttggatccctatcttttcaaaatttgcggttctggacccct |
22627241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 28388292 - 28388238
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||| | || ||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
28388292 |
gcttaattgcgcaattggacccctatctttccaaaaattgaggttatggacccct |
28388238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 390
Target Start/End: Original strand, 29559775 - 29559825
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| || ||||||||| ||||||||| |||||||||| |
|
|
| T |
29559775 |
gcttaattgcacttttggattcctatcttttcaaaagttgcggttatggac |
29559825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 32555765 - 32555819
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
32555765 |
gcttaattgcatttttggacccctatctttttaaaagttgcggttatggccccct |
32555819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 342 - 391
Target Start/End: Original strand, 3738391 - 3738440
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||| ||| ||||| ||| ||||||||| ||||||||||| |
|
|
| T |
3738391 |
ttaattgcacttttggactcctattttttcaaaagttgcggttatggacc |
3738440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 342 - 379
Target Start/End: Complemental strand, 14514994 - 14514957
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
14514994 |
ttaattgcacttttggccccctatctttccaaaagttg |
14514957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 340 - 377
Target Start/End: Complemental strand, 15221526 - 15221489
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagt |
377 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
15221526 |
gcttaattgcacttttggacccatatctttccaaaagt |
15221489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 342 - 391
Target Start/End: Original strand, 33203941 - 33203990
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
||||||||| |||| ||||||||||||| ||||||||| |||||| |||| |
|
|
| T |
33203941 |
ttaattgcaattttggacccctatcttttcaaaagttgcggttatagacc |
33203990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 38992 - 39044
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| || || ||||||| ||||||||| |||||||| ||||| |
|
|
| T |
38992 |
ttaattgcacttttggatccatatcttttcaaaagttgcggttatggtcccct |
39044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 15526981 - 15526929
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
||||||||| | |||| |||| ||||||||||||||||| |||||||||||| |
|
|
| T |
15526981 |
gcttaattggatttttggacctatatctttccaaaagttgcggttatggaccc |
15526929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 25631391 - 25631339
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| || | |||| |||| |||||||| |||||||||||||| |
|
|
| T |
25631391 |
ttaattgcacttttggatctctatttttctaaaagttgcggttatggacccct |
25631339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 343 - 394
Target Start/End: Original strand, 28387984 - 28388036
Alignment:
| Q |
343 |
taattgcactttttgacccc-tatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||| | ||||||||||| |
|
|
| T |
28387984 |
taattgcacttttggaccccctatctttccaaaagttgcgtgtatggacccct |
28388036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 4e-20; HSPs: 150)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 36226727 - 36226673
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36226727 |
gcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
36226673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 4147094 - 4147042
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4147094 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
4147042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 339 - 394
Target Start/End: Original strand, 1657388 - 1657443
Alignment:
| Q |
339 |
tgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1657388 |
tgcttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
1657443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 339 - 394
Target Start/End: Complemental strand, 14032346 - 14032291
Alignment:
| Q |
339 |
tgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14032346 |
tgcttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
14032291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 37205858 - 37205799
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37205858 |
aaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
37205799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 414668 - 414722
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
414668 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
414722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 1657697 - 1657643
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1657697 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
1657643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 2321829 - 2321775
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2321829 |
gcttaattgcacttttggacccctatctttccaaaagttgtggttatgaacccct |
2321775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 5734497 - 5734443
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5734497 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
5734443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 6107429 - 6107375
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6107429 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
6107375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 7151154 - 7151100
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7151154 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
7151100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 14032037 - 14032091
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14032037 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
14032091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 20095687 - 20095741
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20095687 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
20095741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 30359154 - 30359100
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30359154 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
30359100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 30845872 - 30845818
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30845872 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
30845818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 39515559 - 39515613
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39515559 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
39515613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 42267457 - 42267511
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42267457 |
gcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
42267511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 42267770 - 42267716
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42267770 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42267716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 38166486 - 38166539
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38166486 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
38166539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 38166797 - 38166744
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38166797 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
38166744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 1985879 - 1985827
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1985879 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
1985827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 8870260 - 8870312
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8870260 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
8870312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 38593188 - 38593240
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38593188 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
38593240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 23234097 - 23234038
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
23234097 |
aaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
23234038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 32332136 - 32332195
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
32332136 |
aaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttttggacccct |
32332195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 339 - 394
Target Start/End: Original strand, 36801397 - 36801452
Alignment:
| Q |
339 |
tgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
36801397 |
tgcttaattgcacttttggacccctatctttccacaagttgcggttatggacccct |
36801452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 340 - 391
Target Start/End: Complemental strand, 42906686 - 42906635
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42906686 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
42906635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 414967 - 414913
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
414967 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
414913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 2321517 - 2321571
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
2321517 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
2321571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 4132755 - 4132809
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| |||||||||||||| |
|
|
| T |
4132755 |
gcttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
4132809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 4133067 - 4133013
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4133067 |
gcttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
4133013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 4167512 - 4167458
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
4167512 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
4167458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 6014420 - 6014474
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
6014420 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
6014474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 6107118 - 6107172
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
6107118 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
6107172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 14024352 - 14024298
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14024352 |
gcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
14024298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 16531561 - 16531507
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
16531561 |
gcttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
16531507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 17943359 - 17943413
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
17943359 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
17943413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 18553283 - 18553229
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18553283 |
gcttaattgcaattttggacccctatctttccaaaagttgcggttatggacccct |
18553229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 20095999 - 20095945
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
20095999 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatgggcccct |
20095945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 20283987 - 20283933
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
20283987 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
20283933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 20814053 - 20813999
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
20814053 |
gcttaattgcacttttggacccctatctttccaaaacttgcggttatggacccct |
20813999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 21070615 - 21070561
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
21070615 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
21070561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 27822876 - 27822930
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
27822876 |
gcttaattgcacttttggacccctatctttccaaaatttgcggttatggacccct |
27822930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 28596242 - 28596188
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28596242 |
gcttaattgcacttttggatccctatctttctaaaagttgtggttatggacccct |
28596188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 37953375 - 37953429
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
37953375 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
37953429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 39616863 - 39616809
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
39616863 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
39616809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 39626280 - 39626226
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
39626280 |
gcttaattgcacttttggacccctatctttccaaaagctgcggttatggacccct |
39626226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 39635830 - 39635776
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
39635830 |
gcttaattgcacttttggacccctatctttccaaaagctgcggttatggacccct |
39635776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 42642093 - 42642147
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
42642093 |
gcttaattgcacgttttgacccctatctttctaaaagttggggttatggacccct |
42642147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 42642400 - 42642346
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
42642400 |
gcttaattgcacttttggacccctatctttccaaaggttgcggttatggacccct |
42642346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 42906373 - 42906427
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
42906373 |
gcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
42906427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 45106436 - 45106490
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
45106436 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45106490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 6641598 - 6641651
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6641598 |
cttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
6641651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 36788256 - 36788309
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
36788256 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatagacccct |
36788309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 12330076 - 12330128
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
12330076 |
ttaattgcacttttggacccatatctttccaaaagttgcggttatggacccct |
12330128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 20820064 - 20820012
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
20820064 |
gcttaattgcacttttgaacccctatctttccaaaagttgcggttatggaccc |
20820012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 37277770 - 37277718
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
37277770 |
ttaattgcacttttggacccctatcttttcaaaagttatggttatggacccct |
37277718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 37953683 - 37953631
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
37953683 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
37953631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 44886214 - 44886162
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
44886214 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
44886162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 45208979 - 45209031
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
45208979 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
45209031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 339 - 394
Target Start/End: Original strand, 6335332 - 6335387
Alignment:
| Q |
339 |
tgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
6335332 |
tgcttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
6335387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 341 - 388
Target Start/End: Original strand, 20791018 - 20791065
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
20791018 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
20791065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 39515871 - 39515812
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| ||||||||| |||||| ||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
39515871 |
aaaaggcttaattgtacttttggactcctatctttccaaaagttgcggttatggacccct |
39515812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 387
Target Start/End: Complemental strand, 40918686 - 40918639
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
40918686 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
40918639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 45209293 - 45209234
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
45209293 |
aaaaggcttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
45209234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 994994 - 995048
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
994994 |
gcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
995048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 4146786 - 4146840
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
4146786 |
gcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
4146840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 6335640 - 6335586
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| | |||||||||||| |
|
|
| T |
6335640 |
gcttaattgcacttttggacccctatcttttcaaaagttgcgattatggacccct |
6335586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 6641910 - 6641856
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
6641910 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatgaacccct |
6641856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 15187929 - 15187983
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
15187929 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
15187983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 20813737 - 20813791
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| | ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
20813737 |
gcttaattgcacttgtggacccctatcttttcaaaagttgcggttatggacccct |
20813791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 20819753 - 20819807
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
20819753 |
gcttaattgcacttttggaccactatcttttcaaaagttgcggttatggacccct |
20819807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 27339544 - 27339598
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
27339544 |
gcttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
27339598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 30845555 - 30845609
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
30845555 |
gcttaattgtacttttggacccctatctttccaaaagttgcggttatggatccct |
30845609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 31190644 - 31190698
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||||| ||||||| |
|
|
| T |
31190644 |
gcttaattgcacttttggacccctatctttctaaaagttgcggttatagacccct |
31190698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 33947045 - 33947099
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
33947045 |
gcttaattgtacttttggacccctatctttccaaaagttgagattatggacccct |
33947099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 35735505 - 35735558
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
35735505 |
gcttaattgcacttttggaccc-tatctttccaaaagttgcggttatggacccct |
35735558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 41625461 - 41625515
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
41625461 |
gcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
41625515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 45480364 - 45480310
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||| || |||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45480364 |
gcttaactgtacttttggacccctatctttccaaaagttgcggttatggacccct |
45480310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 995305 - 995252
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||| ||| ||||||||| |||||||||||||| |
|
|
| T |
995305 |
cttaattgcacttttggacccctattttttcaaaagttgcggttatggacccct |
995252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 335 - 392
Target Start/End: Complemental strand, 8287921 - 8287864
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||| ||||| |||||||||| ||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
8287921 |
aaaaggcttagttgcacttttggacccctatcttttcaaaagttgcggttatggaccc |
8287864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 8834250 - 8834197
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
8834250 |
cttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
8834197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 333 - 394
Target Start/End: Complemental strand, 31191789 - 31191728
Alignment:
| Q |
333 |
ttaaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||| |||||||||||||||| |||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
31191789 |
ttaaaaggcttaattgcacttttggacctctatctttttaaaagttgcggttatggacccct |
31191728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 41206164 - 41206217
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
41206164 |
cttaattgcacttttggacccatatctttccaaaagttgcggttatggccccct |
41206217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 42363580 - 42363633
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
42363580 |
cttaattgcacttttggacccttatctttccaaaagttgctgttatggacccct |
42363633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 42525019 - 42524966
Alignment:
| Q |
342 |
ttaattgcactttttgacccc-tatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
42525019 |
ttaattgcacttttggaccccctatctttccaaaagttgcggttatggacccct |
42524966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 342 - 387
Target Start/End: Complemental strand, 42930928 - 42930883
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
42930928 |
ttaattgcactttttgacccctatcttttcaaaagttgcggttatg |
42930883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 8870573 - 8870521
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
8870573 |
gcttaattgcatttttgaacccctatctttccaaaagttgcggttatggaccc |
8870521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 14024195 - 14024247
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||| ||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
14024195 |
ttaattgcacgtttggacccctatctttacaaaagttgcggttatggacccct |
14024247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 25249957 - 25250009
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||| |||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
25249957 |
ttaattgtacttttggacccctatcttttcaaaagttgcggttatggacccct |
25250009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 25250256 - 25250204
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| |||||| ||||||| |
|
|
| T |
25250256 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatagacccct |
25250204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 29233545 - 29233597
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||| ||||||| |||||| |
|
|
| T |
29233545 |
ttaattgcacttttggatccctatctttccaaaagttgcggttatgtacccct |
29233597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 32318818 - 32318766
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| ||||||| |||| |
|
|
| T |
32318818 |
gcttaattgcacttttggacccctatctttctaaaagttgcggttatgaaccc |
32318766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 33881397 - 33881345
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
33881397 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
33881345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 37639508 - 37639560
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||| ||||||| |
|
|
| T |
37639508 |
gcttaattgcacttttggacccctatcttttcaaaagttgaggttttggaccc |
37639560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 39625970 - 39626022
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
39625970 |
ttaattgcacttttgaacccctatctttctaaaagttgcggttatggacccct |
39626022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 39635520 - 39635572
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
39635520 |
ttaattgcacttttgaacccctatctttctaaaagttgcggttatggacccct |
39635572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 41015101 - 41015049
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
41015101 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggccccct |
41015049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 41574462 - 41574410
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| | |||||||||||| |
|
|
| T |
41574462 |
ttaattgcacttttggacccctatctttctaaaagttgcgattatggacccct |
41574410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 44885907 - 44885959
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
44885907 |
ttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
44885959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 387
Target Start/End: Complemental strand, 4107160 - 4107113
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||||| |
|
|
| T |
4107160 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
4107113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 5734180 - 5734239
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| ||||||||||| |||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
5734180 |
aaaaggcttaattgcatttttgaacccctatcttttcaaaagttgcggttatggacccct |
5734239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 6655595 - 6655536
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| ||||||||||| |||| || |||||||||||||||||||| ||| |||||||||| |
|
|
| T |
6655595 |
aaaaggcttaattgcatttttggatccctatctttccaaaagttgcggtaatggacccct |
6655536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 6735997 - 6735938
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| ||||||||||| |||| || |||||||||||||||||||| ||| |||||||||| |
|
|
| T |
6735997 |
aaaaggcttaattgcatttttggatccctatctttccaaaagttgcggtaatggacccct |
6735938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 6745311 - 6745252
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| ||||||||| ||| || ||||||| |
|
|
| T |
6745311 |
aaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggtaatagacccct |
6745252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 7013345 - 7013404
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| || |||||||||| ||||||||| |||| ||||||||| |
|
|
| T |
7013345 |
aaaaggcttaattgcacttttagatccctatcttttcaaaagttgcggttttggacccct |
7013404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 390
Target Start/End: Complemental strand, 33877809 - 33877758
Alignment:
| Q |
340 |
gcttaattgcactttttgacccc-tatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| |||||||||||||||||||| |
|
|
| T |
33877809 |
gcttaattgcacttttggaccccctatcttttcaaaagttgtggttatggac |
33877758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 4167205 - 4167259
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| ||||| ||| |||||||||||||||| ||||||| |
|
|
| T |
4167205 |
gcttaattgcacttttggacgcctattttttcaaaagttgtggttattgacccct |
4167259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 6014730 - 6014676
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||| |||||||| |||||||||||||| |
|
|
| T |
6014730 |
gcttaattgcacttttggatccctatctttttaaaagttgcggttatggacccct |
6014676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 332 - 394
Target Start/End: Complemental strand, 7013670 - 7013608
Alignment:
| Q |
332 |
tttaaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||| |||||||||||||||| || | |||||||| ||||||||| |||||| ||||||| |
|
|
| T |
7013670 |
tttaaaaggcttaattgcacttttggatctctatcttttcaaaagttgcggttatagacccct |
7013608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 390
Target Start/End: Original strand, 8833943 - 8833993
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| |||||||| |||||||||| |
|
|
| T |
8833943 |
gcttaattgcacttttggacacctatctttcaaaaagttgcggttatggac |
8833993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 18531145 - 18531091
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||| ||||||| |||||| |
|
|
| T |
18531145 |
gcttaattgcacttttggacccctatctttctaaaagttacggttatgaacccct |
18531091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 386
Target Start/End: Original strand, 23233782 - 23233828
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttat |
386 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||| |
|
|
| T |
23233782 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttat |
23233828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 27872711 - 27872765
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || ||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
27872711 |
gcttaattgcacttttggatccctatctttctaaaagttgcggttatggatccct |
27872765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 29233817 - 29233763
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
29233817 |
gcttaattgcacttttggacctctatctttttaaaagttgcggttatggacccct |
29233763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 37205541 - 37205595
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
37205541 |
gcttaattgcatttttgaacccctatcttttcaaaagttgcggttatggacccct |
37205595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 38593497 - 38593443
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||| ||||||||||||| |||||| ||||||| |
|
|
| T |
38593497 |
gcttaattgcacttttggacctctatatttccaaaagttgcggttattgacccct |
38593443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 41206444 - 41206390
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
41206444 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggccccct |
41206390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 41574156 - 41574210
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||||| |||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
41574156 |
gcttaattgtacttttggacctctattttttcaaaagttgtggttatggacccct |
41574210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 377
Target Start/End: Complemental strand, 7318947 - 7318910
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagt |
377 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7318947 |
gcttaattgcacttttggacccctatctttccaaaagt |
7318910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 393
Target Start/End: Complemental strand, 32693026 - 32692973
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccc |
393 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||| ||| |||||||| |||| |
|
|
| T |
32693026 |
gcttaattgtacttttggacccctatctttccaaaaattgcggttatggccccc |
32692973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 342 - 387
Target Start/End: Original strand, 35409716 - 35409761
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||| ||||||| |
|
|
| T |
35409716 |
ttaattgcacttttggatccctatctttccaaaagttgcggttatg |
35409761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 385
Target Start/End: Complemental strand, 42866405 - 42866360
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggtta |
385 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||| |
|
|
| T |
42866405 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggtta |
42866360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 385
Target Start/End: Original strand, 43657493 - 43657538
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggtta |
385 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||| ||||| |
|
|
| T |
43657493 |
gcttaattgcacttttggacccctaactttccaaaagttgcggtta |
43657538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 385
Target Start/End: Complemental strand, 43658493 - 43658448
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggtta |
385 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||| ||||| |
|
|
| T |
43658493 |
gcttaattgcacttttggacccctaactttccaaaagttgcggtta |
43658448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 358 - 394
Target Start/End: Original strand, 3411420 - 3411456
Alignment:
| Q |
358 |
acccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3411420 |
acccctatctttccaaaagttgcggttatggacccct |
3411456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 15188270 - 15188218
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||| |||||| |||| ||||| ||| ||||||||||||||||||||||| |
|
|
| T |
15188270 |
ttaattgtacttttggacctctatccttctaaaagttgtggttatggacccct |
15188218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 27339855 - 27339803
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
||||||||||| |||| ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
27339855 |
gcttaattgcatttttggacccctatctttttaaaagttgcggttatggaccc |
27339803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 30358844 - 30358896
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| |||| | |||||| ||||||||| |||||||||||| |
|
|
| T |
30358844 |
gcttaattgcacttttggacctcgatcttttcaaaagttgcggttatggaccc |
30358896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 42363882 - 42363830
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||| ||||| |||||||| |||||||||||||| |
|
|
| T |
42363882 |
ttaattgcacttttggacccctttctttttaaaagttgcggttatggacccct |
42363830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 1985565 - 1985624
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| ||||||||| |||||| |||| |||||||| ||| ||||| |||||||||||||| |
|
|
| T |
1985565 |
aaaaggcttaattgtacttttggacctctatcttttcaatagttgcggttatggacccct |
1985624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 342 - 385
Target Start/End: Complemental strand, 3345684 - 3345641
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggtta |
385 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||| ||||| |
|
|
| T |
3345684 |
ttaattgcacttttggacccctaactttccaaaagttgcggtta |
3345641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 387
Target Start/End: Complemental strand, 20791310 - 20791263
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||| ||||||| |
|
|
| T |
20791310 |
gcttaattgcatttttggacctctatctttccaaaagttgcggttatg |
20791263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 390
Target Start/End: Original strand, 29454347 - 29454395
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||| |||||||||| |
|
|
| T |
29454347 |
gcttaattgcacttttggacccct--ctttccaaaagttgcggttatggac |
29454395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 37277456 - 37277515
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| ||||||||| |||||| ||||||||| ||| |||||||| |||||||||||||| |
|
|
| T |
37277456 |
aaaaggcttaattgtacttttggacccctatttttttaaaagttgcggttatggacccct |
37277515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 387
Target Start/End: Complemental strand, 41693364 - 41693317
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||| || || ||||||||||||||||| ||||||| |
|
|
| T |
41693364 |
gcttaattgcacttttggatccttatctttccaaaagttgcggttatg |
41693317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 7150843 - 7150897
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| |||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
7150843 |
gcttaattgcatttttgaacccctatcttttcaaaagttgcagttatggacccct |
7150897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 7653667 - 7653614
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| |||| |||||||||||| |||||||| ||||| |
|
|
| T |
7653667 |
gcttaattgcacttttggacccttatc-ttccaaaagttgcggttatggccccct |
7653614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 20056412 - 20056466
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| || ||||| |||||||||||||| |
|
|
| T |
20056412 |
gcttaattgcacttttggacccttatctttttaatagttgcggttatggacccct |
20056466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 328 - 394
Target Start/End: Original strand, 40918382 - 40918448
Alignment:
| Q |
328 |
tgaatttaaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| | |||||||| ||||||| ||||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
40918382 |
tgaatttaataggcttaatttcacttttggacccctatctttttaaaagttacggttatggccccct |
40918448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 41554899 - 41554845
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || ||||||||||| |||||||| |||| ||| ||||| |
|
|
| T |
41554899 |
gcttaattgcacttttggatccctatctttctaaaagttgcggttgtggccccct |
41554845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 42524711 - 42524765
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || ||||||||||| |||||||| | |||| ||||||| |
|
|
| T |
42524711 |
gcttaattgcacttttggatccctatctttctaaaagttgcgattatagacccct |
42524765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 45516232 - 45516178
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
45516232 |
gcttaattgcatttttggactcctatcttttcaaaagttgcggttatgaacccct |
45516178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 344 - 385
Target Start/End: Original strand, 3340071 - 3340112
Alignment:
| Q |
344 |
aattgcactttttgacccctatctttccaaaagttgtggtta |
385 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||| ||||| |
|
|
| T |
3340071 |
aattgcacttttggacccctaactttccaaaagttgcggtta |
3340112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 340 - 389
Target Start/End: Original strand, 16531249 - 16531298
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgga |
389 |
Q |
| |
|
||||||||| | |||| ||||||||||||| ||||||||| ||||||||| |
|
|
| T |
16531249 |
gcttaattgtatttttggacccctatcttttcaaaagttgcggttatgga |
16531298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 340 - 381
Target Start/End: Complemental strand, 26920028 - 26919987
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtg |
381 |
Q |
| |
|
|||||||||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
26920028 |
gcttaattgcacttttggccccctatcttttcaaaagttgtg |
26919987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 335 - 387
Target Start/End: Complemental strand, 17943656 - 17943604
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||| ||| ||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
17943656 |
aaaaggctaaattgcactttaggacccctatctttccaaaagttacggttatg |
17943604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 335 - 379
Target Start/End: Original strand, 18530828 - 18530872
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
18530828 |
aaaaggcttaattgcacttttgaacccctatcttttcaaaagttg |
18530872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 41788960 - 41788905
Alignment:
| Q |
341 |
cttaattgcactttttgacccc--tatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| |||||| ||||||| ||||||||| ||||||||| |||| |
|
|
| T |
41788960 |
cttaattgcacttttggacccccctatcttttcaaaagttgcggttatggatccct |
41788905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 45106745 - 45106693
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
45106745 |
ttaattgcacttttgaacccctatctttttaaaagttgcggttatggatccct |
45106693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 4e-20; HSPs: 163)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 44214660 - 44214714
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44214660 |
gcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
44214714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 329 - 394
Target Start/End: Original strand, 34288038 - 34288103
Alignment:
| Q |
329 |
gaatttaaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
34288038 |
gaatttaaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
34288103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 334 - 394
Target Start/End: Original strand, 27432485 - 27432545
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27432485 |
taaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27432545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 339 - 394
Target Start/End: Complemental strand, 5097098 - 5097043
Alignment:
| Q |
339 |
tgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5097098 |
tgcttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
5097043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 36376056 - 36376115
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36376056 |
aaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
36376115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 3235428 - 3235374
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3235428 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
3235374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 5096789 - 5096843
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5096789 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
5096843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 7974703 - 7974649
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7974703 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
7974649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 11900051 - 11900105
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11900051 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11900105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 11900362 - 11900308
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11900362 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11900308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 18073817 - 18073871
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18073817 |
gcttaattgcacttttagacccctatctttccaaaagttgcggttatggacccct |
18073871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 18852805 - 18852751
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18852805 |
gcttaattgcacttttggacccctatctttccaaaagttgaggttatggacccct |
18852751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 21782604 - 21782658
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21782604 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
21782658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 24775937 - 24775883
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24775937 |
gcttaattgcacttttggacccctatctctccaaaagttgtggttatggacccct |
24775883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 25982990 - 25983044
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25982990 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
25983044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 34533215 - 34533269
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34533215 |
gcttaattgcacttttggacccctatctttccaaaagttgtggttatgaacccct |
34533269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 35437526 - 35437472
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35437526 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
35437472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 39753873 - 39753927
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39753873 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
39753927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 42997057 - 42997111
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42997057 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42997111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 46622555 - 46622609
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46622555 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
46622609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 35923894 - 35923947
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35923894 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
35923947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 334 - 390
Target Start/End: Complemental strand, 16879556 - 16879500
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
16879556 |
taaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
16879500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 18295855 - 18295907
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18295855 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
18295907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 25987233 - 25987181
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25987233 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
25987181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 334 - 394
Target Start/End: Complemental strand, 32555619 - 32555559
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
32555619 |
taaaaggcttaattgcacttttggacccctatctttcaaaaagttgcggttatggacccct |
32555559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 3925789 - 3925848
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
3925789 |
aaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
3925848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 10350802 - 10350861
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| ||||||||||| |||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10350802 |
aaaaggcttaattgcatttttggacccctatcttttcaaaagttgtggttatggacccct |
10350861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 35924208 - 35924149
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35924208 |
aaaaggcttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
35924149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 340 - 391
Target Start/End: Original strand, 39976730 - 39976781
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39976730 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
39976781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 337 - 388
Target Start/End: Original strand, 44189403 - 44189454
Alignment:
| Q |
337 |
aatgcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
44189403 |
aatgcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
44189454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 931020 - 930966
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
931020 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
930966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 3926070 - 3926016
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
3926070 |
gcttaattgcacttttggacccctatatttccaaaagttgcggttatggacccct |
3926016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 4061300 - 4061246
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4061300 |
gcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
4061246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 9629328 - 9629274
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9629328 |
gcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
9629274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 10312539 - 10312485
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
10312539 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
10312485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 18296163 - 18296109
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
18296163 |
gcttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
18296109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 18852496 - 18852550
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
18852496 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
18852550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 19194161 - 19194215
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
19194161 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatagacccct |
19194215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 19194473 - 19194419
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
19194473 |
gcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
19194419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 20387862 - 20387808
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
20387862 |
gcttaattgcacttttggacccatatcttttcaaaagttgtggttatggacccct |
20387808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 20392336 - 20392282
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
20392336 |
gcttaattgcacttttggacccatatcttttcaaaagttgtggttatggacccct |
20392282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 21782915 - 21782861
Alignment:
| Q |
341 |
cttaattgcactttttgacccc-tatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21782915 |
cttaattgcacttttggaccccctatctttccaaaagttgtggttatggacccct |
21782861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 21917562 - 21917508
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
21917562 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
21917508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 23909896 - 23909950
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
23909896 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
23909950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 25986926 - 25986980
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
25986926 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
25986980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 26612343 - 26612397
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
26612343 |
gcttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
26612397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 26612655 - 26612601
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
26612655 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
26612601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 27512803 - 27512857
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
27512803 |
gcttaattgcacttttggacccctatctttacaaaagttgcggttatggacccct |
27512857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 30140921 - 30140975
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30140921 |
gcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
30140975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 34404444 - 34404498
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
34404444 |
gcttaattgcacttttagacccctatctttccaaaaattgcggttatggacccct |
34404498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 34533525 - 34533471
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
34533525 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34533471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 35121725 - 35121671
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
35121725 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
35121671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 35437207 - 35437261
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35437207 |
gcttaattgcacatttggacccctatctttccaaaagttgcggttatggacccct |
35437261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 37452361 - 37452307
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
37452361 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
37452307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 38445718 - 38445664
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
38445718 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
38445664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 37047977 - 37047924
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
37047977 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
37047924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 342 - 391
Target Start/End: Complemental strand, 48871398 - 48871349
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48871398 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
48871349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 227960 - 228012
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
227960 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
228012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 10319205 - 10319153
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
10319205 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggaccc |
10319153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 334 - 394
Target Start/End: Complemental strand, 18074133 - 18074073
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| |||||||||||||||| ||| ||||||||||||||||||| ||||||||| |||| |
|
|
| T |
18074133 |
taaaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatggatccct |
18074073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 388
Target Start/End: Complemental strand, 19233631 - 19233583
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
19233631 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
19233583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 35711968 - 35711916
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
35711968 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
35711916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 36376372 - 36376320
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
36376372 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggaaccct |
36376320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 38445407 - 38445459
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| || ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38445407 |
ttaattgcacttttggatccctatctttcaaaaagttgtggttatggacccct |
38445459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 45231830 - 45231778
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45231830 |
ttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
45231778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 7974385 - 7974444
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| |||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
7974385 |
aaaaggcttaattgcacttttgaacccctatttttccaaaagttgcggttatggacccct |
7974444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 25036028 - 25036087
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||| ||||||||| ||||||||| |||| |
|
|
| T |
25036028 |
aaaaagcttaattgcactttttgacccctatattttcaaaagttgcggttatggatccct |
25036087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 391
Target Start/End: Complemental strand, 30699336 - 30699285
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
30699336 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacc |
30699285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 327 - 394
Target Start/End: Original strand, 37996005 - 37996072
Alignment:
| Q |
327 |
atgaatttaaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||| | | |||||||||||||||| ||||||||||||| |||| |||| |||||||||||||| |
|
|
| T |
37996005 |
atgaattttataggcttaattgcacttttggacccctatcttttcaaacgttgcggttatggacccct |
37996072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 391
Target Start/End: Original strand, 38053147 - 38053198
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| || |||||||||||| |
|
|
| T |
38053147 |
gcttaattgcacttttggacccctatctttccaaaaattttggttatggacc |
38053198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 38882686 - 38882631
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatc-tttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
38882686 |
gcttaattgcacttttggacccctatcttttccaaaagttgcggttatggacccct |
38882631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 388213 - 388159
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
388213 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
388159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 930709 - 930763
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||| ||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
930709 |
gcttaattacacttttggacccctatcttttcaaaagttgcggttatggacccct |
930763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 16537078 - 16537132
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
16537078 |
gcttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
16537132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 390
Target Start/End: Complemental strand, 16537389 - 16537339
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| ||||||| |||||| ||||||||||||||||||| |
|
|
| T |
16537389 |
gcttaattgcacttttggacccctgtctttcgaaaagttgtggttatggac |
16537339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 390
Target Start/End: Original strand, 16628273 - 16628323
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| ||||||| |||||| ||||||||||||||||||| |
|
|
| T |
16628273 |
gcttaattgcacttttggacccctgtctttcgaaaagttgtggttatggac |
16628323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 16628584 - 16628530
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
16628584 |
gcttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
16628530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 16879236 - 16879290
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
16879236 |
gcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
16879290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 17757771 - 17757825
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
17757771 |
gcttaattgcacttttagacccctatctttttaaaagttgcggttatggacccct |
17757825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 18363296 - 18363350
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||| | |||||||||||| |
|
|
| T |
18363296 |
gcttaattgcacttttggacccctatgtttccaaaagttgcgattatggacccct |
18363350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 18363606 - 18363552
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
18363606 |
gcttaattgcacttttggacccctatctttgcaaaagttgcggttatggatccct |
18363552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 19233341 - 19233395
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| |||||||| ||||| |
|
|
| T |
19233341 |
gcttaattgcacttttggaaccctatctttccaaaagttgcggttatggccccct |
19233395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 23740577 - 23740523
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
23740577 |
gcttaattgtacttttggacccctatctttcgaaaagttgcggttatggacccct |
23740523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 23910167 - 23910113
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
23910167 |
gcttaattgcacttttggaccactatcttttcaaaagttgcggttatggacccct |
23910113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 30141232 - 30141178
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||| ||||||| |
|
|
| T |
30141232 |
gcttaattgcacttttggacccctatctttgcaaaagttgcggttatagacccct |
30141178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 30401220 - 30401166
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| |||||||||||||||||| ||||| |
|
|
| T |
30401220 |
gcttaattgcacttttggactcctatcttttcaaaagttgtggttatggccccct |
30401166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 30699024 - 30699078
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| ||||||||||||| |
|
|
| T |
30699024 |
gcttaattgcacttttggatccctatctttccaaaagttgcagttatggacccct |
30699078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 30757225 - 30757279
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
30757225 |
gcttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
30757279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 35121414 - 35121468
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
35121414 |
gcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
35121468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 38053460 - 38053406
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
38053460 |
gcttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
38053406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 38879462 - 38879408
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| || |||||| |||| |
|
|
| T |
38879462 |
gcttaattgcacttttggacccctatctttccaaaagttgcggctatggatccct |
38879408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 46622865 - 46622811
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
46622865 |
gcttaattgcacttttcaacccctatctttccaaaggttgcggttatggacccct |
46622811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 9035673 - 9035620
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| |||||||||||||| |
|
|
| T |
9035673 |
cttaattgcacttttggattcctatctttccaaaagttgcggttatggacccct |
9035620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 20387555 - 20387608
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
20387555 |
cttaattgcacttttggacccttatctttccaaaagttgcagttatggacccct |
20387608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 20392029 - 20392082
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
20392029 |
cttaattgcacttttggacccttatctttccaaaagttgcagttatggacccct |
20392082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 335 - 392
Target Start/End: Original strand, 23740260 - 23740317
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||| ||||||||||| |||| ||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
23740260 |
aaaaggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
23740317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 335 - 392
Target Start/End: Complemental strand, 27513118 - 27513061
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
27513118 |
aaaaggcttaattgcacttttggacccctatcttttcgaaagttgcggttatggaccc |
27513061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 335 - 388
Target Start/End: Complemental strand, 43408521 - 43408468
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| ||||||||| |||||||| |
|
|
| T |
43408521 |
aaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgg |
43408468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 228268 - 228216
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||| ||||||||| |
|
|
| T |
228268 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttttggacccct |
228216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 340 - 388
Target Start/End: Complemental strand, 10356410 - 10356362
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||| |||||||| |
|
|
| T |
10356410 |
gcttaattgcacttttggacccctatatttccaaaagttgcggttatgg |
10356362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 330 - 394
Target Start/End: Complemental strand, 34404757 - 34404693
Alignment:
| Q |
330 |
aatttaaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| ||| |||||| ||||||||| |||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
34404757 |
aattttaaaggcttaagtgcacttttgaacccttatctttccaaaagttgcggttatggacccct |
34404693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 334 - 394
Target Start/End: Original strand, 35711654 - 35711713
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||| | ||||||| |||||||||||||| |
|
|
| T |
35711654 |
taaaaggcttaattgcacttttggacccctatcttttc-aaagttgcggttatggacccct |
35711713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 37047668 - 37047720
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||| ||| ||||||||| |||||||||||||| |
|
|
| T |
37047668 |
ttaattgcacttttggacccctattttttcaaaagttgcggttatggacccct |
37047720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 346 - 394
Target Start/End: Complemental strand, 39754180 - 39754132
Alignment:
| Q |
346 |
ttgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39754180 |
ttgcatttttggacccctatctttccaaaagttgcggttatggacccct |
39754132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 335 - 387
Target Start/End: Original strand, 40436032 - 40436084
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
40436032 |
aaaaggcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
40436084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 340 - 388
Target Start/End: Original strand, 43632342 - 43632390
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||| |||||||| |
|
|
| T |
43632342 |
gcttaattgcacttttggacccctatctttccaaaaattgcggttatgg |
43632390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 10318887 - 10318946
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| ||||||||| |||||| |||||| |
|
|
| T |
10318887 |
aaaaggcttaattgcacttttggacccctatcttttcaaaagttgcagttatgaacccct |
10318946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 379
Target Start/End: Complemental strand, 10385761 - 10385722
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10385761 |
gcttaattgcacttttggacccctatctttccaaaagttg |
10385722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 387
Target Start/End: Complemental strand, 19778566 - 19778519
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||||| |
|
|
| T |
19778566 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
19778519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 21917082 - 21917141
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| || |||||| ||| ||||||||| |||||||||||||| |
|
|
| T |
21917082 |
aaaaggcttaattgcacttttggatccctattttttcaaaagttgcggttatggacccct |
21917141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Complemental strand, 47732014 - 47731963
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
||||||||||||||| ||||| ||||||| ||||||||| |||||||||||| |
|
|
| T |
47732014 |
cttaattgcacttttggacccttatcttttcaaaagttgcggttatggaccc |
47731963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 497113 - 497167
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| ||||||||| ||||||||||||| |
|
|
| T |
497113 |
gcttaattgcacttttggacccttatcttttcaaaagttgcagttatggacccct |
497167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 10351118 - 10351064
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
10351118 |
gcttaattgcacttttggaccccaatcttttcaaaagttacggttatggacccct |
10351064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 342 - 388
Target Start/End: Original strand, 11275190 - 11275236
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
11275190 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatgg |
11275236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 11578368 - 11578314
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||| |||| ||||||||| |||| |
|
|
| T |
11578368 |
gcttaattgtacttttggacccctatctttccaaaggttgcggttatggatccct |
11578314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 342 - 388
Target Start/End: Original strand, 19778277 - 19778323
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||||||| |
|
|
| T |
19778277 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatgg |
19778323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 378
Target Start/End: Complemental strand, 25683987 - 25683949
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagtt |
378 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25683987 |
gcttaattgcacttttggacccctatctttccaaaagtt |
25683949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 341 - 391
Target Start/End: Original strand, 30028396 - 30028446
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| ||||||||||| |
|
|
| T |
30028396 |
cttaattgcactttaggacccctatctttctaaaagttgcggttatggacc |
30028446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 34288363 - 34288309
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||| |||||||||||||| |
|
|
| T |
34288363 |
gcttaattgcacttttgaacccctatctttttaaaagttgcggttatggacccct |
34288309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 38879162 - 38879216
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||||| |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
38879162 |
gcttaattgtacttttggacctctatcttttcaaaagttgcggttatggacccct |
38879216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 45231523 - 45231577
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
45231523 |
gcttaattgcacttttggacccctatcttttcaaaagttacggttatggatccct |
45231577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 47731703 - 47731757
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||| ||| |||||||||||||| |
|
|
| T |
47731703 |
gcttaattgcacttttggacccctatcttttaaaaaattgcggttatggacccct |
47731757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 342 - 387
Target Start/End: Complemental strand, 3931804 - 3931759
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
3931804 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatg |
3931759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 4060990 - 4061043
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
4060990 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatgaacccct |
4061043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 385
Target Start/End: Original strand, 10715839 - 10715884
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggtta |
385 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||| ||||| |
|
|
| T |
10715839 |
gcttaattgcacttttggacccctaactttccaaaagttgcggtta |
10715884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 342 - 387
Target Start/End: Original strand, 18798033 - 18798078
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
18798033 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatg |
18798078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 342 - 391
Target Start/End: Complemental strand, 23359004 - 23358955
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
||||||||| |||| |||||||||||||| ||||||||| |||||||||| |
|
|
| T |
23359004 |
ttaattgcatttttggacccctatctttctaaaagttgttgttatggacc |
23358955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 385
Target Start/End: Original strand, 30085622 - 30085667
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggtta |
385 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||| ||||| |
|
|
| T |
30085622 |
gcttaattgcacttttggacccctaactttccaaaagttgcggtta |
30085667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 385
Target Start/End: Complemental strand, 30086615 - 30086570
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggtta |
385 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||| ||||| |
|
|
| T |
30086615 |
gcttaattgcacttttggacccctaactttccaaaagttgcggtta |
30086570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 37996322 - 37996269
Alignment:
| Q |
342 |
ttaattgcactttttga-cccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||| || ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37996322 |
ttaattgcatttttggatcccctatctttccaaaagttgcggttatggacccct |
37996269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 5181741 - 5181689
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| ||| ||||||||||||| |
|
|
| T |
5181741 |
ttaattgcacttttagacccctatcttttcaaaaattgcagttatggacccct |
5181689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 340 - 388
Target Start/End: Original strand, 10385470 - 10385518
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| |||||||| |||||||| |
|
|
| T |
10385470 |
gcttaattgcacttttagacccttatctttctaaaagttgcggttatgg |
10385518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 11578058 - 11578110
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||| |||||| |||||||||| ||| |||||||| |||||||||||||| |
|
|
| T |
11578058 |
ttaattgtacttttggacccctatcattcaaaaagttgcggttatggacccct |
11578110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 386
Target Start/End: Complemental strand, 18798320 - 18798276
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttat |
386 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||| |||||| |
|
|
| T |
18798320 |
ttaattgcacttttggatccctatctttccaaaagttgcggttat |
18798276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 331 - 379
Target Start/End: Complemental strand, 21954396 - 21954348
Alignment:
| Q |
331 |
atttaaaatgcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21954396 |
atttaaaaggcttaattgcacttttgaccccctatctttccaaaagttg |
21954348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 30028693 - 30028641
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||| | ||||||| ||||||||||||||||||| |||| |
|
|
| T |
30028693 |
ttaattgcacttttggactcttatcttttcaaaagttgtggttatggatccct |
30028641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 30757534 - 30757482
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||| ||| |||||||| |||||||||||||| |
|
|
| T |
30757534 |
ttaattgcacttttggacccctatttttttaaaagttgcggttatggacccct |
30757482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 331 - 379
Target Start/End: Original strand, 36203988 - 36204035
Alignment:
| Q |
331 |
atttaaaatgcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
36203988 |
atttaaaaggcttaattgcactttt-gacccctatctttctaaaagttg |
36204035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 340 - 388
Target Start/End: Original strand, 43408225 - 43408273
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||| ||||||| |||| |||||||||||||||||| |||||||| |
|
|
| T |
43408225 |
gcttaatttcacttttggacctctatctttccaaaagttgcggttatgg |
43408273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 347 - 394
Target Start/End: Complemental strand, 497417 - 497370
Alignment:
| Q |
347 |
tgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| | ||| |||||||| |
|
|
| T |
497417 |
tgcactttttgacccttatctttccaaaagttgcgtttacggacccct |
497370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 387
Target Start/End: Original strand, 3931647 - 3931694
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||||||||| ||||||| |
|
|
| T |
3931647 |
gcttaattgcacttttggacctctatcttttcaaaagttggggttatg |
3931694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 391
Target Start/End: Original strand, 9035359 - 9035410
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
||||||||||| |||| ||||||||||||| |||||||| ||||||||||| |
|
|
| T |
9035359 |
gcttaattgcaattttggacccctatctttttaaaagttgcggttatggacc |
9035410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 359 - 394
Target Start/End: Original strand, 24236134 - 24236169
Alignment:
| Q |
359 |
cccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24236134 |
cccctatctttccaaaagttgcggttatggacccct |
24236169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 387
Target Start/End: Complemental strand, 25036345 - 25036298
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||| || |||||||||| |||||||||||||||| |
|
|
| T |
25036345 |
gcttaattgcacttttggatccctatctttttaaaagttgtggttatg |
25036298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 379
Target Start/End: Original strand, 29163101 - 29163140
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
29163101 |
gcttaattgcactttttgccccctatcttttcaaaagttg |
29163140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 379
Target Start/End: Complemental strand, 31530431 - 31530392
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
31530431 |
gcttaattgcacttttggccccctatctttccaaaagttg |
31530392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 37452047 - 37452106
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| || || ||||||| ||||||||| ||||||||| |||| |
|
|
| T |
37452047 |
aaaaggcttaattgcacttttagatccatatcttttcaaaagttgcggttatggatccct |
37452106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 334 - 381
Target Start/End: Complemental strand, 39142508 - 39142461
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtg |
381 |
Q |
| |
|
||||| |||||||||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
39142508 |
taaaaggcttaattgcacttttggtcccctatcttttcaaaagttgtg |
39142461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 10356118 - 10356172
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| || | |||||||||||||||||| |||||||| ||||| |
|
|
| T |
10356118 |
gcttaattgcatttttagatctctatctttccaaaagttgcggttatggccccct |
10356172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 342 - 388
Target Start/End: Original strand, 10986003 - 10986049
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||| |||| |||||||| ||||||||| |||||||| |
|
|
| T |
10986003 |
ttaattgcacttttagacctctatcttttcaaaagttgcggttatgg |
10986049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 11275477 - 11275423
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||| ||| ||| ||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
11275477 |
gcttaattacacctttggacccctatcttttcaaaagttgcggttatggccccct |
11275423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 24236420 - 24236366
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| |||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
24236420 |
gcttaattgcatttttgcacccgtatctttctaaaagttgcggttatggacccct |
24236366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 25983303 - 25983249
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| | || |||||||| |||||||| |||||||||||||| |
|
|
| T |
25983303 |
gcttaattgcacttttgggcctctatctttttaaaagttgcggttatggacccct |
25983249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 38882371 - 38882425
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| |||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
38882371 |
gcttaattgcatttttgtacccctatcttttcaaaagttgcggttatgaacccct |
38882425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 40436288 - 40436234
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||| ||||||||||||||||| | |||||| ||||| |
|
|
| T |
40436288 |
gcttaattgcatttttggacccttatctttccaaaagttgcgattatggccccct |
40436234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 386
Target Start/End: Complemental strand, 42997364 - 42997318
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttat |
386 |
Q |
| |
|
||||||||||| |||| ||||||||||||| ||||||||| |||||| |
|
|
| T |
42997364 |
gcttaattgcatttttggacccctatcttttcaaaagttgcggttat |
42997318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 342 - 388
Target Start/End: Complemental strand, 44189694 - 44189648
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||| | ||||||||||||| ||||||||| |||||||| |
|
|
| T |
44189694 |
ttaattgcacttctggacccctatcttttcaaaagttgcggttatgg |
44189648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 342 - 388
Target Start/End: Complemental strand, 49081643 - 49081597
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||| || |||||||||| ||||||||| |||||||| |
|
|
| T |
49081643 |
ttaattgcacttttagatccctatcttttcaaaagttgcggttatgg |
49081597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 17758073 - 17758021
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||| || |||||||||| |||| |
|
|
| T |
17758073 |
cttaattgcacttttggacctctatctttccaaaa-ttatggttatggatccct |
17758021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 342 - 379
Target Start/End: Complemental strand, 21202912 - 21202875
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
21202912 |
ttaattgcacttttggccccctatctttccaaaagttg |
21202875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 342 - 379
Target Start/End: Original strand, 48925914 - 48925951
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
48925914 |
ttaattgcactttttgtcccctatcttttcaaaagttg |
48925951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 7195459 - 7195511
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||| ||||||||||||| ||||||||| |||||||| |||| |
|
|
| T |
7195459 |
ttaattgcatttttggacccctatcttttcaaaagttgcagttatggatccct |
7195511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 340 - 380
Target Start/End: Complemental strand, 37858364 - 37858325
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgt |
380 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
37858364 |
gcttaattgcactttt-gacccctatcttttcaaaagttgt |
37858325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 51; Significance: 4e-20; HSPs: 99)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 27223621 - 27223567
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27223621 |
gcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
27223567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 31740765 - 31740824
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31740765 |
aaaaggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
31740824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 2100693 - 2100639
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2100693 |
gcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
2100639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 4405553 - 4405499
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4405553 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
4405499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 6261382 - 6261436
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6261382 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
6261436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 6261689 - 6261635
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6261689 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
6261635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 7391486 - 7391540
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7391486 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
7391540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 11213495 - 11213441
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11213495 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11213441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 13042409 - 13042463
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13042409 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
13042463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 23291257 - 23291311
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23291257 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
23291311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 334 - 394
Target Start/End: Complemental strand, 1815294 - 1815234
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
1815294 |
taaaaggcttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
1815234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 27765261 - 27765313
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27765261 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27765313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 10893885 - 10893944
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
10893885 |
aaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
10893944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 339 - 394
Target Start/End: Original strand, 22279499 - 22279554
Alignment:
| Q |
339 |
tgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
22279499 |
tgcttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
22279554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 331 - 394
Target Start/End: Complemental strand, 29697164 - 29697101
Alignment:
| Q |
331 |
atttaaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||| | |||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29697164 |
atttaataggcttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
29697101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 30239521 - 30239462
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30239521 |
aaaaggcttaattgcacttttagacccctatctttccaaaagttgcagttatggacccct |
30239462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 30966009 - 30965950
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
30966009 |
aaaaggcttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
30965950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 31833583 - 31833524
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
31833583 |
aaaaggcttaattgcacttttggacccctatctttccaaaaattgcggttatggacccct |
31833524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 1814977 - 1815031
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
1814977 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
1815031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 7391789 - 7391735
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
7391789 |
gcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
7391735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 10977659 - 10977713
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
10977659 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
10977713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 11322337 - 11322283
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
11322337 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
11322283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 11614899 - 11614953
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
11614899 |
gcttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
11614953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 11745999 - 11746053
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
11745999 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggtcccct |
11746053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 13042720 - 13042666
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
13042720 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
13042666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 14997010 - 14997064
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14997010 |
gcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
14997064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 18683013 - 18683067
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
18683013 |
gcttaattgcacttttggacctctatcttttcaaaagttgtggttatggacccct |
18683067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 20080119 - 20080173
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
20080119 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
20080173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 20630661 - 20630607
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
20630661 |
gcttaattgcacttttagacctctatctttccaaaagttgcggttatggacccct |
20630607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 23883400 - 23883346
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
23883400 |
gcttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
23883346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 25749956 - 25750010
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
25749956 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
25750010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 26716683 - 26716629
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
26716683 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
26716629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 29696849 - 29696903
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
29696849 |
gcttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
29696903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 390
Target Start/End: Complemental strand, 31951513 - 31951463
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
31951513 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
31951463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 333 - 386
Target Start/End: Original strand, 1896892 - 1896945
Alignment:
| Q |
333 |
ttaaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttat |
386 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
1896892 |
ttaaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttat |
1896945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 331 - 388
Target Start/End: Original strand, 15272990 - 15273047
Alignment:
| Q |
331 |
atttaaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||| ||| |||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
15272990 |
attttaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
15273047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 31741082 - 31741029
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
31741082 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
31741029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 334 - 394
Target Start/End: Original strand, 2565073 - 2565133
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
2565073 |
taaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
2565133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 334 - 394
Target Start/End: Complemental strand, 5606615 - 5606555
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| |||||||||||||||| |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
5606615 |
taaaaggcttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
5606555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 9703854 - 9703802
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
9703854 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
9703802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 15150038 - 15149986
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
15150038 |
ttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
15149986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 16735877 - 16735825
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
16735877 |
gcttaattgcacttttggacccctatttttccaaaagttgcggttatggaccc |
16735825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 343 - 394
Target Start/End: Original strand, 12256768 - 12256819
Alignment:
| Q |
343 |
taattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
12256768 |
taattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
12256819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 383
Target Start/End: Complemental strand, 23585290 - 23585247
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggt |
383 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23585290 |
gcttaattgcacttttggacccctatctttccaaaagttgtggt |
23585247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 28563637 - 28563578
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| |||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
28563637 |
aaaaggcttaattgcacttttggacctctatctttcaaaaagttgcggttatggacccct |
28563578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 391
Target Start/End: Complemental strand, 34705688 - 34705637
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| ||||||||||| |
|
|
| T |
34705688 |
gcttaattgcacttttggacccctatctttctaaaagttgcggttatggacc |
34705637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 3185469 - 3185415
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| | ||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
3185469 |
gcttaattgcacttttggtcccctatcttttcaaaagttgcggttatggacccct |
3185415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 5606297 - 5606351
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
5606297 |
gcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
5606351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 10894182 - 10894128
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| |||||||| ||||| |
|
|
| T |
10894182 |
gcttaattgcacttttggacctctatctttccaaaagttgcggttatggccccct |
10894128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 11321903 - 11321957
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
11321903 |
gcttaattgcacttttggacccctatttttttaaaagttgtggttatggacccct |
11321957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 11746291 - 11746237
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
11746291 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggccccct |
11746237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 12257076 - 12257022
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
12257076 |
gcttaattgcacttttggacctttatctttccaaaagttgcggttatggacccct |
12257022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 14997321 - 14997267
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||| ||||||| |
|
|
| T |
14997321 |
gcttaattgcacttttggacccctatctttgcaaaagttgcggttatagacccct |
14997267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 15711948 - 15711894
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
15711948 |
gcttaattgcacttttcgacccctatctttttaaaagttgcggttatggacccct |
15711894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 16765042 - 16765096
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
16765042 |
gcttaattgtacttttggacccctatctttccaaaagttgcggttatgcacccct |
16765096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 18683322 - 18683268
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||| ||||||| ||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
18683322 |
gcttaatttcacttttggacccctatttttccaaaagttgcggttatggacccct |
18683268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 20630353 - 20630407
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
20630353 |
gcttaattgcacttatggacccctatctttccaaaagttgcggttatagacccct |
20630407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 21003369 - 21003423
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
21003369 |
gcttaattgcacttttggacccctaactttccaaaagttgcggttacggacccct |
21003423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 23883090 - 23883144
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
23883090 |
gcttaattgcacttttggacccttatcttttcaaaagttgcggttatggacccct |
23883144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 28563328 - 28563382
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||| ||||| |||||||| |||||||||||||| |
|
|
| T |
28563328 |
gcttaattgcacttttggacccctacctttctaaaagttgcggttatggacccct |
28563382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 30965692 - 30965746
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
30965692 |
gcttaattgcacttttggacccctatcttttcaaaagttgcagttatggacccct |
30965746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 340 - 389
Target Start/End: Complemental strand, 2565391 - 2565342
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgga |
389 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||||||| |
|
|
| T |
2565391 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatgga |
2565342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 3195718 - 3195771
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
3195718 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
3195771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 3534800 - 3534853
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
3534800 |
cttaattacacttttggacccctatctttccaaaagttgcggttatggtcccct |
3534853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 335 - 392
Target Start/End: Original strand, 28930460 - 28930517
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||| |||||||||||||||| |||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
28930460 |
aaaaagcttaattgcacttttggacctctatcttttcaaaagttgcggttatggaccc |
28930517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 3196024 - 3195972
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| || || ||||||| |||||||||||||||||||||| |
|
|
| T |
3196024 |
gcttaattgcacttttggatccttatcttttcaaaagttgtggttatggaccc |
3195972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 3535089 - 3535037
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
3535089 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggccccct |
3535037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 11445979 - 11446031
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
11445979 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
11446031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 15273289 - 15273237
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
15273289 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggccccct |
15273237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 17965842 - 17965894
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| || |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
17965842 |
ttaattgcacttttggatccctatcttttcaaaagttggggttatggacccct |
17965894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 28930776 - 28930724
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||| ||||| |
|
|
| T |
28930776 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatcgaccc |
28930724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 339 - 387
Target Start/End: Original strand, 31833266 - 31833314
Alignment:
| Q |
339 |
tgcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||| ||||||| |
|
|
| T |
31833266 |
tgcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
31833314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 387
Target Start/End: Original strand, 2100381 - 2100428
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| ||||||| |
|
|
| T |
2100381 |
gcttaattgcacttttggacctctatctttccaaaagttgcggttatg |
2100428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 391
Target Start/End: Complemental strand, 26171519 - 26171468
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||| | ||||||||| |
|
|
| T |
26171519 |
gcttaattgcacttttggacccctatctttccaaaacttgcgattatggacc |
26171468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 10977968 - 10977918
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
||||||||| |||| ||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
10977968 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
10977918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 13440188 - 13440134
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| | ||||||||||||||||| ||||| |||||||| |
|
|
| T |
13440188 |
gcttaattgcacttttggactcttatctttccaaaagttgcggttacggacccct |
13440134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 390
Target Start/End: Original strand, 15149728 - 15149778
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| ||||||||| |||||||||| |
|
|
| T |
15149728 |
gcttaattgcacttttggactcctatcttttcaaaagttgcggttatggac |
15149778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 16765349 - 16765296
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| | ||||||| |||||||||||||| |
|
|
| T |
16765349 |
gcttaattgcacttttggacccctatctttac-aaagttgaggttatggacccct |
16765296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 390
Target Start/End: Original strand, 30818219 - 30818269
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||| ||||||||||| ||||||||||||| ||||||||| |||||||||| |
|
|
| T |
30818219 |
gcttgattgcacttttggacccctatcttttcaaaagttgcggttatggac |
30818269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 30818527 - 30818473
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| | |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
30818527 |
gcttaattgcacttttgaatccctatcttttcaaaagttgcggttatggacccct |
30818473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 377
Target Start/End: Complemental strand, 9126687 - 9126650
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagt |
377 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9126687 |
gcttaattgcacttttggacccctatctttccaaaagt |
9126650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 385
Target Start/End: Original strand, 28931950 - 28931995
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggtta |
385 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||| ||||| |
|
|
| T |
28931950 |
gcttaattgcacttttggacccctaactttccaaaagttgcggtta |
28931995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 385
Target Start/End: Complemental strand, 28932949 - 28932904
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggtta |
385 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||| ||||| |
|
|
| T |
28932949 |
gcttaattgcacttttggacccctaactttccaaaagttgcggtta |
28932904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 13439880 - 13439932
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||| | |||||||||||| |
|
|
| T |
13439880 |
ttaattgcacttttgaactcctatctttccaaaagttgcgtttatggacccct |
13439932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 387
Target Start/End: Complemental strand, 1897191 - 1897144
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||| ||||||| |
|
|
| T |
1897191 |
gcttaattgcatttttgaacccctatctttccaaaagttgcggttatg |
1897144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 344 - 387
Target Start/End: Original strand, 3185238 - 3185281
Alignment:
| Q |
344 |
aattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
3185238 |
aattgcactttaggacccctatctttccaaaagttgaggttatg |
3185281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 342 - 393
Target Start/End: Original strand, 31951208 - 31951259
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccc |
393 |
Q |
| |
|
||||||||| |||| ||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
31951208 |
ttaattgcatttttggacccctatctttttaaaagttgcggttatggacccc |
31951259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 386
Target Start/End: Original strand, 11277627 - 11277673
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttat |
386 |
Q |
| |
|
||||||||||| |||| ||||||||||||| ||||||||| |||||| |
|
|
| T |
11277627 |
gcttaattgcatttttggacccctatcttttcaaaagttgcggttat |
11277673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 342 - 392
Target Start/End: Complemental strand, 11277927 - 11277877
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
||||||| |||||| ||||||||||||| ||||||||| ||||||| |||| |
|
|
| T |
11277927 |
ttaattgtacttttggacccctatcttttcaaaagttgcggttatgaaccc |
11277877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 11615211 - 11615157
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| | |||||||||| |||||||| |||||||||||||| |
|
|
| T |
11615211 |
gcttaattgcacttttgggtccctatctttttaaaagttgcggttatggacccct |
11615157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 20080411 - 20080357
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||||| ||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
20080411 |
gcttaattgtacttttggacccctatctttgtaaaagttgcggttatggccccct |
20080357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 21008728 - 21008782
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| |||| ||||||| ||||||||||||||||| |||||| |
|
|
| T |
21008728 |
gcttaattgcatttttagacctttatcttttcaaaagttgtggttatgaacccct |
21008782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 27771526 - 27771472
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||| ||||||| ||||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
27771526 |
gcttaattacacttttggacccttatctttttaaaagttgcggttatggacccct |
27771472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 340 - 389
Target Start/End: Complemental strand, 3194748 - 3194699
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgga |
389 |
Q |
| |
|
|||||||||||||||| ||| | |||||||| |||||||| ||||||||| |
|
|
| T |
3194748 |
gcttaattgcacttttggactcatatctttctaaaagttgcggttatgga |
3194699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 342 - 379
Target Start/End: Original strand, 9067455 - 9067492
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
9067455 |
ttaattgcactttttgatccctatcttcccaaaagttg |
9067492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 340 - 381
Target Start/End: Complemental strand, 21009055 - 21009014
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtg |
381 |
Q |
| |
|
|||||||| ||||||| |||| |||||||||||||||||||| |
|
|
| T |
21009055 |
gcttaattacacttttggacctctatctttccaaaagttgtg |
21009014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 335 - 392
Target Start/End: Original strand, 34705372 - 34705429
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||| ||||||||||| |||| ||||||||| ||| ||||||||| |||| ||||||| |
|
|
| T |
34705372 |
aaaaggcttaattgcatttttggacccctatattttcaaaagttgcggttctggaccc |
34705429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 342 - 390
Target Start/End: Complemental strand, 22279808 - 22279760
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||| ||| |||||||||| |
|
|
| T |
22279808 |
ttaattgcacttttgaacccctatcttttcaaaaattgcggttatggac |
22279760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 340 - 388
Target Start/End: Complemental strand, 26479355 - 26479307
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| || |||||| ||||||||||||| ||||||| |
|
|
| T |
26479355 |
gcttaattgcacttttggatccctatttttccaaaagttgcagttatgg |
26479307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 4e-20; HSPs: 173)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 257748 - 257694
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
257748 |
gcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
257694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 28964466 - 28964412
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28964466 |
gcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
28964412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 41281846 - 41281900
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41281846 |
gcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
41281900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 334 - 394
Target Start/End: Complemental strand, 2239548 - 2239488
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2239548 |
taaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
2239488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 17916400 - 17916341
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17916400 |
aaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
17916341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 37182000 - 37182059
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37182000 |
aaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
37182059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 339 - 394
Target Start/End: Complemental strand, 44177598 - 44177543
Alignment:
| Q |
339 |
tgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44177598 |
tgcttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
44177543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 53192110 - 53192169
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53192110 |
aaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
53192169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 3212464 - 3212410
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3212464 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
3212410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 5577245 - 5577191
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5577245 |
gcttaattgcacttttggacccctatctttccaaaagttgaggttatggacccct |
5577191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 8313950 - 8314004
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8313950 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
8314004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 10864116 - 10864170
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10864116 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
10864170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 17483562 - 17483616
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17483562 |
gcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
17483616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 19391639 - 19391693
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19391639 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
19391693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 19392015 - 19391961
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19392015 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
19391961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 19914784 - 19914730
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19914784 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
19914730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 21841728 - 21841782
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21841728 |
gcttaattgcacttttggacccctatctttccaaaagttgtggttatggccccct |
21841782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 22202485 - 22202539
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22202485 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
22202539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 27748555 - 27748501
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27748555 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27748501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 27766519 - 27766573
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27766519 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27766573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 27766829 - 27766775
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27766829 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27766775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 27857447 - 27857393
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27857447 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27857393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 28964154 - 28964208
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28964154 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
28964208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 42230343 - 42230289
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42230343 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42230289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 44177289 - 44177343
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44177289 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
44177343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 44183973 - 44184027
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44183973 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
44184027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 44184283 - 44184229
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44184283 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
44184229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 44895960 - 44895906
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44895960 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
44895906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 45743900 - 45743954
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45743900 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
45743954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 45760233 - 45760287
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
45760233 |
gcttaattgcactttttgacctctatctttccaaaagttgcggttatggacccct |
45760287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 47530340 - 47530394
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47530340 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
47530394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 47530652 - 47530598
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47530652 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
47530598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 52916860 - 52916914
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52916860 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52916914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 53532118 - 53532064
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53532118 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
53532064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 2205540 - 2205592
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2205540 |
ttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
2205592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 30200419 - 30200471
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30200419 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
30200471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 33252795 - 33252743
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33252795 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
33252743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 334 - 394
Target Start/End: Original strand, 41722049 - 41722109
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| |||||||||||||||| ||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
41722049 |
taaaaggcttaattgcacttttggacccctatatttccaaaagttgcggttatggacccct |
41722109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 53422092 - 53422144
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53422092 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
53422144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 33576726 - 33576667
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
33576726 |
aaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
33576667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 340 - 391
Target Start/End: Complemental strand, 53192425 - 53192374
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
53192425 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
53192374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 2118714 - 2118768
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
2118714 |
gcttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
2118768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 9633710 - 9633656
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9633710 |
gcttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
9633656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 12881236 - 12881290
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
12881236 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
12881290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 12881527 - 12881473
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
12881527 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
12881473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 19914477 - 19914531
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
19914477 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
19914531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 25126310 - 25126256
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
25126310 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
25126256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 25782654 - 25782708
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||| |||||| |
|
|
| T |
25782654 |
gcttaattgcactttttgacccctatttttccaaaagttgcggttatgaacccct |
25782708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 390
Target Start/End: Original strand, 26494686 - 26494736
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
26494686 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
26494736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 27748245 - 27748299
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
27748245 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
27748299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 30200726 - 30200672
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
30200726 |
gcttaattgcacttttagactcctatctttccaaaagttgcggttatggacccct |
30200672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 31117621 - 31117675
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
31117621 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
31117675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 31869507 - 31869453
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
31869507 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttttggacccct |
31869453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 32508231 - 32508177
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
32508231 |
gcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
32508177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 33621867 - 33621921
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
33621867 |
gcttaattgcacttttggacccctatctttacaaaagttgcggttatggacccct |
33621921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 41282159 - 41282105
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
41282159 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
41282105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 42465692 - 42465746
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
42465692 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggtcccct |
42465746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 45760545 - 45760491
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
45760545 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45760491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 47943772 - 47943718
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
47943772 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
47943718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 8727915 - 8727968
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
8727915 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
8727968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 9079802 - 9079855
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
9079802 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
9079855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 41223824 - 41223771
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41223824 |
cttaattgcacttttggacccctatctttttaaaagttgtggttatggacccct |
41223771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 51843113 - 51843060
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
51843113 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
51843060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 335 - 388
Target Start/End: Complemental strand, 52613639 - 52613586
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||| |||||||| |
|
|
| T |
52613639 |
aaaatgcttaattgcacttttggacccctatcttttcaaaagttgcggttatgg |
52613586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 388
Target Start/End: Complemental strand, 20982571 - 20982523
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
20982571 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
20982523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 388
Target Start/End: Complemental strand, 25053896 - 25053848
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
25053896 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
25053848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 29168732 - 29168784
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
29168732 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
29168784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 33576410 - 33576462
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
33576410 |
ttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
33576462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 334 - 394
Target Start/End: Complemental strand, 36017079 - 36017019
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| |||||||| ||||||| ||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
36017079 |
taaaaggcttaatttcacttttagacccctatctttccaaaagttgcggttatgcacccct |
36017019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 41722296 - 41722244
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
41722296 |
gcttaattgcacttttgaacccctatcttttcaaaagttgtggttatggaccc |
41722244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 388
Target Start/End: Complemental strand, 47423440 - 47423392
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
47423440 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
47423392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 391
Target Start/End: Complemental strand, 3384300 - 3384249
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
3384300 |
gcttaattgcacttttgaacccctatctttccaaaagttgcggttatggacc |
3384249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 331 - 394
Target Start/End: Complemental strand, 7858283 - 7858220
Alignment:
| Q |
331 |
atttaaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| ||| |||||||||||||||| || |||||||||||||||||||| |||||||| ||||| |
|
|
| T |
7858283 |
attttaaaggcttaattgcacttttggatccctatctttccaaaagttgcggttatggccccct |
7858220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 25782970 - 25782911
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||| | ||||||||||||||||| |||||||||||||| |
|
|
| T |
25782970 |
aaaaggcttaattgcacttttagacacttatctttccaaaagttgcggttatggacccct |
25782911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 391
Target Start/End: Complemental strand, 27984444 - 27984393
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27984444 |
gcttaattacacttttggacccctatctttccaaaagttgcggttatggacc |
27984393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 28097741 - 28097682
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||| ||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
28097741 |
aaaaggcttaattccacttttggacccctatcttttcaaaagttgcggttatggacccct |
28097682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 391
Target Start/End: Complemental strand, 32205159 - 32205108
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
32205159 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacc |
32205108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 36441641 - 36441582
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
36441641 |
aaaatgcttaattgcacttttgaatccctatcttttcaaaagttgcggttatggacccct |
36441582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 42230029 - 42230088
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| |||| |||||||||||||||||| ||||||||| |||| |
|
|
| T |
42230029 |
aaaaggcttaattgcacttttggacctctatctttccaaaagttgcggttatggatccct |
42230088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 342 - 389
Target Start/End: Original strand, 53190964 - 53191011
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatgga |
389 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
53190964 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgga |
53191011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 787100 - 787154
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
787100 |
gcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
787154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 390
Target Start/End: Complemental strand, 2119026 - 2118976
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||| |
|
|
| T |
2119026 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
2118976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 2239228 - 2239282
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
2239228 |
gcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
2239282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 10864431 - 10864377
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
10864431 |
gcttaattgcacttttggacccctatctttccaaaagttgcagttatgaacccct |
10864377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 11963037 - 11962983
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
11963037 |
gcttaattgcacttttggacccctaactttccaaaagttgcggttacggacccct |
11962983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 14133641 - 14133695
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||| |||||||| ||||| |
|
|
| T |
14133641 |
gcttagttgcactttttgacccctatctttccaaaacttgcggttatggccccct |
14133695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 14133932 - 14133879
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14133932 |
gcttaatt-cacttttggacccctatctttccaaaagttgtggttatggccccct |
14133879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 17483870 - 17483816
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
17483870 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
17483816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 20982281 - 20982335
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
20982281 |
gcttaattgcacttttggacccctatctttctaaaagttgcggttatggccccct |
20982335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 333 - 394
Target Start/End: Original strand, 24393684 - 24393746
Alignment:
| Q |
333 |
ttaaaatgcttaattgcactttttgacccc-tatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||| |||||||||||||||| |||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
24393684 |
ttaaaaggcttaattgcacttttggaccccctatctttttaaaagttgtggttatggacccct |
24393746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 390
Target Start/End: Original strand, 24636351 - 24636401
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
||||||||| |||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
24636351 |
gcttaattgtacttttggacccctatcttttcaaaagttgtggttatggac |
24636401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 28097418 - 28097472
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
28097418 |
gcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
28097472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 30761112 - 30761058
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
30761112 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
30761058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 341 - 391
Target Start/End: Complemental strand, 31577731 - 31577681
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
31577731 |
cttaattgcacttttggacccctatctttttaaaagttgtggttatggacc |
31577681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 32204849 - 32204903
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| | |||||||||||| |
|
|
| T |
32204849 |
gcttaattgcacttttggacctctatctttccaaaagttgcgcttatggacccct |
32204903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 38511969 - 38511915
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||| ||||||| |
|
|
| T |
38511969 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatagacccct |
38511915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 41223514 - 41223568
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||| ||||||| |
|
|
| T |
41223514 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatagacccct |
41223568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 44624538 - 44624484
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
44624538 |
gcttaattgcacttttggacccctatcttttcaaaagttacggttatggacccct |
44624484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 45744211 - 45744157
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || | |||||||||||||||||| |||||||||||||| |
|
|
| T |
45744211 |
gcttaattgcacttttggatctctatctttccaaaagttgcggttatggacccct |
45744157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 47943460 - 47943514
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
47943460 |
gcttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
47943514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 49997656 - 49997710
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||| ||||||||| |||| |
|
|
| T |
49997656 |
gcttaattgcacttttggacccctatttttccaaaagttgcggttatggatccct |
49997710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 49997968 - 49997914
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
49997968 |
gcttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
49997914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 50033553 - 50033499
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||| |||| |||||||||||||| |
|
|
| T |
50033553 |
gcttaattgcacttttggacccctatcttttcaaaggttgcggttatggacccct |
50033499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 52917631 - 52917577
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
52917631 |
gcttaattgcacttttgggcccctatctttccaaaagttgcggttatggatccct |
52917577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 53191275 - 53191221
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
53191275 |
gcttaattgcatttttggacccctatctttccaaaagttgcggttatggatccct |
53191221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 53531807 - 53531861
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||| |||||||| |
|
|
| T |
53531807 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttaaggacccct |
53531861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 787411 - 787358
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| || |||||| ||||||||||||| |||||||||||||| |
|
|
| T |
787411 |
cttaattgcacttttggatccctatttttccaaaagttgcggttatggacccct |
787358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 339 - 392
Target Start/End: Complemental strand, 24394005 - 24393952
Alignment:
| Q |
339 |
tgcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
||||||||||||||||| || ||||||||| |||||||||||||||||||||| |
|
|
| T |
24394005 |
tgcttaattgcacttttggattcctatcttttcaaaagttgtggttatggaccc |
24393952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 335 - 392
Target Start/End: Original strand, 32507923 - 32507980
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||| |||||||||||||||| ||||||||| ||| ||||||||| |||||||||||| |
|
|
| T |
32507923 |
aaaaggcttaattgcacttttggacccctattttttcaaaagttgcggttatggaccc |
32507980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 33622177 - 33622124
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| || |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
33622177 |
cttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
33622124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 340 - 393
Target Start/End: Original strand, 51213308 - 51213361
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccc |
393 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
51213308 |
gcttaattgcacttttggacccctatcttttcaaaagttgcgattatggacccc |
51213361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 332 - 385
Target Start/End: Complemental strand, 54718168 - 54718115
Alignment:
| Q |
332 |
tttaaaatgcttaattgcactttttgacccctatctttccaaaagttgtggtta |
385 |
Q |
| |
|
||||||| |||||||||||||||| |||||||| |||||||||||||| ||||| |
|
|
| T |
54718168 |
tttaaaaggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
54718115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 36373857 - 36373805
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||| |||||||||||| |
|
|
| T |
36373857 |
gcttaattgcacttttggatccctatcttttcaaaagttgcggttatggaccc |
36373805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 38511660 - 38511712
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||| |||||||||||| |
|
|
| T |
38511660 |
gcttaattgcacttttggatccctatcttttcaaaagttgcggttatggaccc |
38511712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 335 - 387
Target Start/End: Complemental strand, 40082507 - 40082455
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
40082507 |
aaaaggcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
40082455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 47722152 - 47722204
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
47722152 |
ttaattgcacttttgaacccctatctttccaaaagttgcggttatggatccct |
47722204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 387
Target Start/End: Original strand, 2711702 - 2711749
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
2711702 |
gcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
2711749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 391
Target Start/End: Complemental strand, 5154093 - 5154042
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||||| |||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
5154093 |
gcttaattgcacttttggaccactatttttccaaaagttgcggttatggacc |
5154042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 32459100 - 32459041
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| ||||||||||| |||| || | |||||||||||||||||| |||||||||||||| |
|
|
| T |
32459100 |
aaaaggcttaattgcatttttggatctctatctttccaaaagttgcggttatggacccct |
32459041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 344 - 394
Target Start/End: Original strand, 3212158 - 3212208
Alignment:
| Q |
344 |
aattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||| ||||||| |||||| |
|
|
| T |
3212158 |
aattgcacttttggacccctatctttctaaaagttgcggttatgaacccct |
3212208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 390
Target Start/End: Original strand, 9153478 - 9153528
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||| |||| |
|
|
| T |
9153478 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttaaggac |
9153528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 9630769 - 9630823
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
9630769 |
gcttaattgcacttttggatccctatcttttcaaaagttgcggttatgaacccct |
9630823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 10439287 - 10439341
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||| ||| ||||||||||||||||||||||| |
|
|
| T |
10439287 |
gcttaattgcacttttggacctctatttttttaaaagttgtggttatggacccct |
10439341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 11961866 - 11961920
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||| |||| ||||||||| ||||| |||||||| |
|
|
| T |
11961866 |
gcttaattgcacttttggacccctaacttttcaaaagttgcggttacggacccct |
11961920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 21842023 - 21841969
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||||||||| |||||||| ||||| |
|
|
| T |
21842023 |
gcttaattgcacttttagacctctatcttttcaaaagttgcggttatggccccct |
21841969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 27448815 - 27448869
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
27448815 |
gcttaattgtacttttgaacccctatctttccaaaagttgcggttatggtcccct |
27448869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 341 - 387
Target Start/End: Complemental strand, 27719997 - 27719951
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| ||||||| |
|
|
| T |
27719997 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
27719951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 29169040 - 29168986
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
29169040 |
gcttaattgcacttttagacatctatcttttcaaaagttgcggttatggacccct |
29168986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 33252485 - 33252539
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||||| |||||||||||||| |||||||| | |||||||||||| |
|
|
| T |
33252485 |
gcttaattgtacttttggacccctatctttctaaaagttgcgattatggacccct |
33252539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 33933680 - 33933626
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| | ||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
33933680 |
gcttaattgcaattttggccccctatctttccaaaagttgcggttatagacccct |
33933626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 390
Target Start/End: Original strand, 36441483 - 36441533
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| |||||||| |||||||||| |
|
|
| T |
36441483 |
gcttaattgcacttttggactcctatctttctaaaagttgcggttatggac |
36441533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 341 - 387
Target Start/End: Original strand, 39905730 - 39905776
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| ||||||| |
|
|
| T |
39905730 |
cttaattgcactttttgacctctatcttttcaaaagttgcggttatg |
39905776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 338 - 384
Target Start/End: Original strand, 44701814 - 44701860
Alignment:
| Q |
338 |
atgcttaattgcactttttgacccctatctttccaaaagttgtggtt |
384 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||| |||| |
|
|
| T |
44701814 |
atgcttaattgcacttttggccccctatctttccaaaagttgcggtt |
44701860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 44895650 - 44895704
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| | |||||||||||| |
|
|
| T |
44895650 |
gcttaattgcacttttggacccctatctttttaaaagttgcgattatggacccct |
44895704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 46934300 - 46934246
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| | |||||| ||||| |
|
|
| T |
46934300 |
gcttaattgcacttttggccccctatctttccaaaagttgcgattatggccccct |
46934246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 50033314 - 50033368
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||| ||||||||| |||| |
|
|
| T |
50033314 |
gcttaattgcacttttagacctctatctttccaaaagttacggttatggatccct |
50033368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 51214471 - 51214417
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
51214471 |
gcttaattgcacttttggacctctatctttttaaaagttgcggttatggacccct |
51214417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 51842802 - 51842856
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || | |||||||| ||||||||| |||||||||||||| |
|
|
| T |
51842802 |
gcttaattgcacttttagatctctatcttttcaaaagttgcggttatggacccct |
51842856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 332 - 385
Target Start/End: Original strand, 54717157 - 54717211
Alignment:
| Q |
332 |
tttaaaatg-cttaattgcactttttgacccctatctttccaaaagttgtggtta |
385 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||| |||||||||||||| ||||| |
|
|
| T |
54717157 |
tttaaaatggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
54717211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 9153788 - 9153735
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||| |||||||||||||| |
|
|
| T |
9153788 |
cttaattgcacttttggactcctatctttctaaaagttacggttatggacccct |
9153735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 377
Target Start/End: Original strand, 14904443 - 14904480
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagt |
377 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14904443 |
gcttaattgcacttttggacccctatctttccaaaagt |
14904480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 389
Target Start/End: Original strand, 27984140 - 27984189
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgga |
389 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| ||||||||| |
|
|
| T |
27984140 |
gcttaattgcacttttggacccctatctttttaaaagttgcggttatgga |
27984189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 337 - 394
Target Start/End: Complemental strand, 44702182 - 44702125
Alignment:
| Q |
337 |
aatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| ||||||||||| || ||| ||||| |
|
|
| T |
44702182 |
aatgcttaattacactttttgccccctatcttttcaaaagttgtgattttggccccct |
44702125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 386
Target Start/End: Complemental strand, 2205838 - 2205794
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttat |
386 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||| |||||| |
|
|
| T |
2205838 |
ttaattgcacttttggacccctatctttccaaaaattgcggttat |
2205794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 390
Target Start/End: Original strand, 7818936 - 7818984
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| |||||||||| |
|
|
| T |
7818936 |
ttaattgcacttttgaacccctatctttctaaaagttgcggttatggac |
7818984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 378
Target Start/End: Complemental strand, 8728222 - 8728186
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagtt |
378 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8728222 |
ttaattgcacttttggacccctatctttccaaaagtt |
8728186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 378
Target Start/End: Complemental strand, 9080109 - 9080073
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagtt |
378 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9080109 |
ttaattgcacttttggacccctatctttccaaaagtt |
9080073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 10439590 - 10439538
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||| ||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
10439590 |
ttaattgcatttttggacccttatcttttcaaaagttgcggttatggacccct |
10439538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 32458782 - 32458834
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||| ||| ||||||||||||||||||| |||||| ||||||| |
|
|
| T |
32458782 |
ttaattgcatttttggactcctatctttccaaaagttgcggttatagacccct |
32458834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 32594079 - 32594027
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||| |||||| |||| |||||||| |||||||||||||||||| ||||| |
|
|
| T |
32594079 |
ttaattgtacttttggacctctatcttttcaaaagttgtggttatggccccct |
32594027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 47423150 - 47423202
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||| ||||||| ||||||||| |||||||| ||||| |
|
|
| T |
47423150 |
ttaattgcacttttggacccttatcttttcaaaagttgcggttatggccccct |
47423202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 53422387 - 53422335
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||| ||||||| |||||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
53422387 |
ttaattacacttttagacccctatctttctaaaagttgcggttatggatccct |
53422335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 342 - 377
Target Start/End: Original strand, 39708013 - 39708048
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagt |
377 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39708013 |
ttaattgcacttttcgacccctatctttccaaaagt |
39708048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 387
Target Start/End: Original strand, 40082213 - 40082260
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| ||||||||| ||||||| |
|
|
| T |
40082213 |
gcttaattgcacttttggacacctatcttttcaaaagttgcggttatg |
40082260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 387
Target Start/End: Original strand, 51336891 - 51336938
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| ||||||||| ||||||| |
|
|
| T |
51336891 |
gcttaattgcacttttggactcctatcttttcaaaagttgcggttatg |
51336938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 379
Target Start/End: Original strand, 53764576 - 53764615
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
53764576 |
gcttaattgcacttttggccccctatctttccaaaagttg |
53764615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 5576934 - 5576988
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||||| ||||||||||||| |||||||| ||||||| |||||| |
|
|
| T |
5576934 |
gcttaattgtacttttggacccctatctttttaaaagttgcggttatgcacccct |
5576988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 8315393 - 8315339
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||| |||||| ||||||| |
|
|
| T |
8315393 |
gcttaattgcacttttgaacccctattttttcaaaagttgcggttatagacccct |
8315339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 352 - 394
Target Start/End: Original strand, 21689943 - 21689985
Alignment:
| Q |
352 |
tttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
21689943 |
ttttggacccctatctttccaaaagttgcggttatggccccct |
21689985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 21690181 - 21690127
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||| ||||| |
|
|
| T |
21690181 |
gcttaattgcacttttgcccccctatctttccaaaagttacggttatgggcccct |
21690127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 31117931 - 31117877
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||| ||||||| |||| |||||||||||||||||| |
|
|
| T |
31117931 |
gcttaattgcaattttggacccatatctttttaaaaattgtggttatggacccct |
31117877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 31869197 - 31869250
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||| |||| |||||||| |||||||||||||| |
|
|
| T |
31869197 |
gcttaattgcacttttggaccc-tatttttctaaaagttgcggttatggacccct |
31869250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 37182311 - 37182257
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||| || | ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
37182311 |
gcttaattgcggttatggacccctatcttttcaaaagttgcggttatggacccct |
37182257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 353 - 394
Target Start/End: Complemental strand, 47360525 - 47360484
Alignment:
| Q |
353 |
ttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
47360525 |
ttttgacccctatctttttaaaagttgcggttatggacccct |
47360484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 342 - 387
Target Start/End: Original strand, 49859528 - 49859573
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||| ||| |||||||||| |||||||| ||||||| |
|
|
| T |
49859528 |
ttaattgcacttttggactcctatctttctaaaagttgcggttatg |
49859573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 340 - 381
Target Start/End: Original strand, 54716477 - 54716518
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtg |
381 |
Q |
| |
|
|||||||||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
54716477 |
gcttaattgcacttttggccccctatcttttcaaaagttgtg |
54716518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 5153784 - 5153836
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||| |||||||| ||||||| |||||||||||||| |
|
|
| T |
5153784 |
ttaattgcacttttggacctctatctttttaaaagttacggttatggacccct |
5153836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 9793231 - 9793179
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| ||| | ||||||| ||||| ||| |||||||||||| |
|
|
| T |
9793231 |
gcttaattgcacttttggactcttatcttttcaaaaattgcggttatggaccc |
9793179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 22202793 - 22202741
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| || |||||||||| |||||||| ||||||||| |||| |
|
|
| T |
22202793 |
ttaattgcacttttggatccctatcttttcaaaagttacggttatggatccct |
22202741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 31577423 - 31577474
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||| ||| |||||||||||||| |
|
|
| T |
31577423 |
ttaattgcactttt-gacccctatctttttaaaaattgcggttatggacccct |
31577474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 48160486 - 48160538
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| ||| ||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
48160486 |
ttaattgcatatttggacccctatcttttcaaaagttgcggttatggatccct |
48160538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 51860335 - 51860386
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
||||||||||| |||| ||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
51860335 |
gcttaattgcatttttggacccctatcttttc-aaagttgcggttatggaccc |
51860386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 51860638 - 51860586
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||| || ||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
51860638 |
ttaattgtacctttagacccctatctttttaaaagttgcggttatggacccct |
51860586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 2646 - 2699
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2646 |
cttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
2699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 2957 - 2903
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||| |||| |||||||| |||||||||||||| |
|
|
| T |
2957 |
gcttaattgcacttttggacccttatttttctaaaagttggggttatggacccct |
2903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 6e-19; HSPs: 167)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 334 - 394
Target Start/End: Original strand, 11018396 - 11018456
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11018396 |
taaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11018456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 12690017 - 12690076
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12690017 |
aaaaggcttaattgcacttttggacccctatctttccaaaagttgaggttatggacccct |
12690076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 8774299 - 8774353
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8774299 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
8774353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 9058167 - 9058221
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9058167 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
9058221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 11052209 - 11052155
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11052209 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11052155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 11204508 - 11204562
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11204508 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11204562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 15161610 - 15161556
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15161610 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
15161556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 20596175 - 20596121
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20596175 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
20596121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 23342273 - 23342219
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23342273 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
23342219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 23356694 - 23356748
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23356694 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
23356748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 26861275 - 26861329
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26861275 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
26861329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 32341496 - 32341550
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32341496 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
32341550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 42407197 - 42407143
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42407197 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42407143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 43914892 - 43914838
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43914892 |
gcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
43914838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 45885261 - 45885207
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45885261 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
45885207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 47113390 - 47113443
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47113390 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
47113443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 11204809 - 11204757
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11204809 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11204757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 25098442 - 25098390
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25098442 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
25098390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 32558215 - 32558267
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32558215 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
32558267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 52143168 - 52143220
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52143168 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52143220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 32341809 - 32341750
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
32341809 |
aaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
32341750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 43914574 - 43914633
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
43914574 |
aaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
43914633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 331 - 386
Target Start/End: Original strand, 45012624 - 45012679
Alignment:
| Q |
331 |
atttaaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttat |
386 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
45012624 |
atttaaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttat |
45012679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 922475 - 922421
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
922475 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
922421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 2371178 - 2371232
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
2371178 |
gcttaattgcacttttggacccctatctttcaaaaagttgcggttatggacccct |
2371232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 3264001 - 3264055
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3264001 |
gcttaattgcacttttggacccctatctttccaaaagttacggttatggacccct |
3264055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 6182983 - 6183037
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
6182983 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
6183037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 6491728 - 6491674
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
6491728 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
6491674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 7598610 - 7598664
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
7598610 |
gcttaattgcacttttggacccatatctttccaaaagttgcggttatggacccct |
7598664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 334 - 392
Target Start/End: Original strand, 8770458 - 8770516
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
8770458 |
taaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggaccc |
8770516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 11018714 - 11018660
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
11018714 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
11018660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 11051897 - 11051951
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
11051897 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttattgacccct |
11051951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 13791887 - 13791833
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
13791887 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
13791833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 15161298 - 15161352
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
15161298 |
gcttaattgcacttttggacccatatctttccaaaagttgcggttatggacccct |
15161352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 20471415 - 20471469
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
20471415 |
gcttaattgcacttttagacctctatctttccaaaagttgcggttatggacccct |
20471469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 20560122 - 20560068
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
20560122 |
gcttaattgcacttttagacctctatctttccaaaagttgcggttatggacccct |
20560068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 22204306 - 22204360
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
22204306 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
22204360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 23341965 - 23342019
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
23341965 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
23342019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 390
Target Start/End: Complemental strand, 23793094 - 23793044
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
23793094 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggac |
23793044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 27396838 - 27396784
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
27396838 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggatccct |
27396784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 29794694 - 29794748
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29794694 |
gcttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
29794748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 30288177 - 30288231
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
30288177 |
gcttaattgcacttttggacccctatctttccagaagttgcggttatggacccct |
30288231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 37029240 - 37029186
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
37029240 |
gcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
37029186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 38622715 - 38622661
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
38622715 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
38622661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 39427725 - 39427671
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39427725 |
gcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
39427671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 45664452 - 45664398
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
45664452 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
45664398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 45884949 - 45885003
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
45884949 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45885003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 46320988 - 46320934
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
46320988 |
gcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
46320934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 52143477 - 52143423
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
52143477 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
52143423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 52149826 - 52149772
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
52149826 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
52149772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 52233432 - 52233486
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
52233432 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
52233486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 14460303 - 14460356
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14460303 |
cttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
14460356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 342 - 387
Target Start/End: Original strand, 21727615 - 21727660
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
21727615 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatg |
21727660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 21727926 - 21727873
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
21727926 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
21727873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 331 - 387
Target Start/End: Original strand, 30289160 - 30289217
Alignment:
| Q |
331 |
atttaaaatgcttaattgcactttttgacccc-tatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||| |||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
30289160 |
atttaaaaggcttaattgcacttttagaccccctatctttccaaaagttgtggttatg |
30289217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 340 - 393
Target Start/End: Original strand, 31797065 - 31797118
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccc |
393 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
31797065 |
gcttaattgcacttttggacccctatctttccaaaaattgcggttatggacccc |
31797118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 34988397 - 34988344
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
34988397 |
cttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
34988344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 345 - 394
Target Start/End: Complemental strand, 36139664 - 36139615
Alignment:
| Q |
345 |
attgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36139664 |
attgcacttttggacccctatctttccaaaagttgcggttatggacccct |
36139615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 333 - 394
Target Start/End: Complemental strand, 47113706 - 47113645
Alignment:
| Q |
333 |
ttaaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
47113706 |
ttaaaaggcttaattgcacttttggacccctatcttttcaaaatttgcggttatggacccct |
47113645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 52363490 - 52363437
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
52363490 |
cttaattgcattttttgacccctatctttccaaaagttgcggttatgaacccct |
52363437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 6809379 - 6809327
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6809379 |
ttaattgcatttttggacccctatcttttcaaaagttgtggttatggacccct |
6809327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 8535826 - 8535774
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
8535826 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
8535774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 8601065 - 8601013
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
8601065 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
8601013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 8770775 - 8770723
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
8770775 |
gcttaattgcacttttggacccctatttttccaaaagttgcggttatggaccc |
8770723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 19830421 - 19830369
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
19830421 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
19830369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 30295182 - 30295130
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
30295182 |
gcttaattgcacttttggacccctatctttctaaaagttgtggttatagaccc |
30295130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 36139369 - 36139421
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36139369 |
ttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
36139421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 40355851 - 40355903
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
40355851 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
40355903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 52149520 - 52149572
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
52149520 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
52149572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 335 - 390
Target Start/End: Original strand, 20224074 - 20224129
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||| ||||||||| |||||||||| |
|
|
| T |
20224074 |
aaaatgcttaattgcacttttggactcctatcttttcaaaagttgcggttatggac |
20224129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 387
Target Start/End: Complemental strand, 26435002 - 26434955
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
26435002 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
26434955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 343 - 394
Target Start/End: Complemental strand, 29795003 - 29794952
Alignment:
| Q |
343 |
taattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
29795003 |
taattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
29794952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 39427407 - 39427466
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
39427407 |
aaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggatccct |
39427466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 343 - 394
Target Start/End: Complemental strand, 40356158 - 40356107
Alignment:
| Q |
343 |
taattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40356158 |
taattgcacttttggacccctatctttttaaaagttgtggttatggacccct |
40356107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 49056124 - 49056179
Alignment:
| Q |
340 |
gcttaattgcactttttgacccc-tatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
49056124 |
gcttaattgcacttttggaccccctatctttccaaaagttgcggttatggacccct |
49056179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 49056435 - 49056380
Alignment:
| Q |
340 |
gcttaattgcactttttgacccc-tatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
49056435 |
gcttaattgcacttttggaccccctatctttccaaaagttgcggttatggacccct |
49056380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 14741 - 14795
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
14741 |
gcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
14795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 2371489 - 2371435
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
2371489 |
gcttaattgcacttttggacccctatcttttaaaaagttgcggttatggacccct |
2371435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 6183294 - 6183240
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||| |||||||| |
|
|
| T |
6183294 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttaaggacccct |
6183240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 6809069 - 6809123
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
6809069 |
gcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
6809123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 8028961 - 8029015
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
8028961 |
gcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
8029015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 9517251 - 9517305
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||| ||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
9517251 |
gcttaattgctcttttggacccctatcttttcaaaagttgcggttatggacccct |
9517305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 18589850 - 18589904
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| |||||||| ||||| |
|
|
| T |
18589850 |
gcttaattgcacttttggacctctatctttccaaaagttgcggttatggtcccct |
18589904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 390
Target Start/End: Complemental strand, 20017689 - 20017639
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| | |||||||| |
|
|
| T |
20017689 |
gcttaattgcacttttggacccctatctttccaaaagttgcgtttatggac |
20017639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 20224388 - 20224334
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
20224388 |
gcttaattgtacttttggacccctatcttttcaaaagttgcggttatggacccct |
20224334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 20471724 - 20471670
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20471724 |
gcttaattgcatttttgaacccctatctttccaaaagttgcggttatggacccct |
20471670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 20559813 - 20559867
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20559813 |
gcttaattgcatttttgaacccctatctttccaaaagttgcggttatggacccct |
20559867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 390
Target Start/End: Complemental strand, 22204618 - 22204568
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| |||||||||| |
|
|
| T |
22204618 |
gcttaattgcacttttggacctctatctttccaaaagttgcggttatggac |
22204568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 28503448 - 28503394
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
28503448 |
gcttaattgcacttttggacccctatcttttcaaaagttacggttatggacccct |
28503394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 30294871 - 30294925
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
30294871 |
gcttaattgcacttttggacccctatctttctaaaagttgcggttatggatccct |
30294925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 32038151 - 32038097
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || ||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
32038151 |
gcttaattgcacttttggatccctatctttctaaaagttgtggttatagacccct |
32038097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 342 - 388
Target Start/End: Original strand, 36230555 - 36230601
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
36230555 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgg |
36230601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 37028929 - 37028983
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
37028929 |
gcttaattgcacttttggacccctatcttttcaaaagttgcagttatggacccct |
37028983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 336 - 394
Target Start/End: Complemental strand, 41585601 - 41585543
Alignment:
| Q |
336 |
aaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
41585601 |
aaatgcttaattgcacttttggacctctatctttttaaaagttgcggttatggacccct |
41585543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 42406884 - 42406938
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
42406884 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
42406938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 43677104 - 43677158
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| ||||||| |||||| |
|
|
| T |
43677104 |
gcttaattgcacttttggatccctatctttccaaaagttgcggttatgaacccct |
43677158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 44846919 - 44846973
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
44846919 |
gcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
44846973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 49227428 - 49227374
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||| | |||||||||||||| |
|
|
| T |
49227428 |
gcttaattgcacttttggacccctaactttccaaaagtcgcggttatggacccct |
49227374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 51272990 - 51272936
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
51272990 |
gcttaattgcacttttagacccttatctttcaaaaagttgcggttatggacccct |
51272936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 335 - 392
Target Start/End: Complemental strand, 7598923 - 7598866
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||| ||||||||||| |||| ||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
7598923 |
aaaaggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
7598866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 45680093 - 45680146
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| || |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
45680093 |
cttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
45680146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 1480555 - 1480503
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
1480555 |
ttaattgcacttttgtacccctatctttccaaaagttgcggttatggatccct |
1480503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 4243133 - 4243185
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||| |||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
4243133 |
ttaattgtacttttggacccctatctttctaaaagttgcggttatggacccct |
4243185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 9517556 - 9517504
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
9517556 |
ttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
9517504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 340 - 388
Target Start/End: Complemental strand, 10279989 - 10279941
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||| |||||||| |
|
|
| T |
10279989 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgg |
10279941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 13791579 - 13791631
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||| |||||| ||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
13791579 |
ttaattgtacttttggactcctatctttccaaaagttgcggttatggacccct |
13791631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 14460612 - 14460560
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||| |||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
14460612 |
ttaattgtacttttggacccctatctttctaaaagttgcggttatggacccct |
14460560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 390
Target Start/End: Complemental strand, 20359308 - 20359260
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
20359308 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggac |
20359260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 390
Target Start/End: Original strand, 20551662 - 20551710
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
20551662 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggac |
20551710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 343 - 391
Target Start/End: Complemental strand, 23357003 - 23356955
Alignment:
| Q |
343 |
taattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
23357003 |
taattgcacttttggacccctatcttttcaaaagttgcggttatggacc |
23356955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 335 - 391
Target Start/End: Complemental strand, 25820870 - 25820814
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||| |||||||||||||||| |||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
25820870 |
aaaaggcttaattgcacttttggacccctaactttccaaaagttgcggttacggacc |
25820814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 340 - 388
Target Start/End: Original strand, 40618731 - 40618779
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||| |||||||| |
|
|
| T |
40618731 |
gcttaattgcacttttggacccctatatttccaaaagttgcggttatgg |
40618779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 49227123 - 49227175
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
49227123 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
49227175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 6491412 - 6491471
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| |||| |||||||| ||||||||| ||||||| |||||| |
|
|
| T |
6491412 |
aaaaggcttaattgcacttttggacctctatcttttcaaaagttgcggttatgaacccct |
6491471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 339 - 394
Target Start/End: Complemental strand, 8029270 - 8029215
Alignment:
| Q |
339 |
tgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||| |||||||| |||| |
|
|
| T |
8029270 |
tgcttaattgcacttttggatccctatctttccaaaagttgcagttatggatccct |
8029215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 391
Target Start/End: Original strand, 8535529 - 8535580
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||| ||||||||| ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
8535529 |
gcttaactgcacttttggacccctatttttctaaaagttgtggttatggacc |
8535580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 391
Target Start/End: Original strand, 8600768 - 8600819
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||| ||||||||| ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
8600768 |
gcttaactgcacttttggacccctatttttctaaaagttgtggttatggacc |
8600819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 9053715 - 9053660
Alignment:
| Q |
340 |
gcttaattgcactttttgacccc-tatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
9053715 |
gcttaattgcacttttggaccccctatcttttcaaaagttgcggttatggacccct |
9053660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 335 - 390
Target Start/End: Original strand, 12071640 - 12071695
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||| |||||||| ||||||| |||||||||||||| |||||||| |||||||||| |
|
|
| T |
12071640 |
aaaaggcttaattacacttttggacccctatctttcaaaaagttgcggttatggac |
12071695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 391
Target Start/End: Original strand, 23792781 - 23792832
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||| ||||||| ||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
23792781 |
gcttaattacacttttggacacctatctttccaaaagttgcggttatggacc |
23792832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 391
Target Start/End: Original strand, 25820111 - 25820162
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
25820111 |
gcttaattgcacttttggacccctaactttccaaaagttgcggttacggacc |
25820162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 28503131 - 28503190
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||| ||||||| |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
28503131 |
aaaaggcttaattacacttttagacctctatcttttcaaaagttgcggttatggacccct |
28503190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 2372724 - 2372670
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
2372724 |
gcttaattgcaattttggacccctatctttttaaaagttgcggttatggacccct |
2372670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 2383347 - 2383401
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
2383347 |
gcttaattgcaattttggacccctatctttttaaaagttgcggttatggacccct |
2383401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 8774609 - 8774555
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |||||| |||||| |
|
|
| T |
8774609 |
gcttaattgcacttttggacccttatctttccaaaagttgcagttatgaacccct |
8774555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 12071957 - 12071903
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || | |||||||||||||||||| |||||| ||||||| |
|
|
| T |
12071957 |
gcttaattgcacttttggatctctatctttccaaaagttgcggttatagacccct |
12071903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 16490975 - 16491029
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
16490975 |
gcttaattgcatttttggacccctatcttttcaaaagttgcggttatgaacccct |
16491029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 20287768 - 20287822
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || ||||| |||||||||||||| ||||||| |||||| |
|
|
| T |
20287768 |
gcttaattgcacttttggaaccctacctttccaaaagttgcggttatgaacccct |
20287822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 22071166 - 22071216
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
||||||||| |||| ||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
22071166 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
22071216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 386
Target Start/End: Complemental strand, 22075663 - 22075617
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttat |
386 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||| |
|
|
| T |
22075663 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttat |
22075617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 23208618 - 23208564
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| ||| |||||| ||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
23208618 |
gcttagttgtacttttggacccctatctttccaaaagttgcggttacggacccct |
23208564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 390
Target Start/End: Original strand, 27396529 - 27396579
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||| ||||||| || ||||||||||| ||||||||||||||||||| |
|
|
| T |
27396529 |
gcttaatttcacttttggatccctatctttctaaaagttgtggttatggac |
27396579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 40814888 - 40814941
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
40814888 |
gcttaattgcacttttggaccc-tatctttccaaaagttgcggttatggccccct |
40814941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 43670626 - 43670572
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||| ||| ||||||||| ||||||||||||| |||||||| ||||| |
|
|
| T |
43670626 |
gcttaattgcacatttggacccctatatttccaaaagttgcggttatggccccct |
43670572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 47764092 - 47764146
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| |||| ||| ||||||||| |||||||||||||| |
|
|
| T |
47764092 |
gcttaattgcacttttggacctctattttttcaaaagttgcggttatggacccct |
47764146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 19830116 - 19830169
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||| |||||||| |||||||| || ||||||||||| |
|
|
| T |
19830116 |
cttaattgcacttttggacccttatctttcaaaaagttgcggctatggacccct |
19830169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 29704619 - 29704672
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| |||| |||||||| ||||||||| |||||| ||||||| |
|
|
| T |
29704619 |
cttaattgcacttttggacctctatcttttcaaaagttgcggttatagacccct |
29704672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 389
Target Start/End: Complemental strand, 33811737 - 33811688
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgga |
389 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
33811737 |
gcttaattgcatttttggacccctatctttccaaaagttgcggtgatgga |
33811688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 389
Target Start/End: Complemental strand, 33871207 - 33871158
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgga |
389 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
33871207 |
gcttaattgcatttttggacccctatctttccaaaagttgcggtgatgga |
33871158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 389
Target Start/End: Original strand, 46320677 - 46320726
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgga |
389 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| ||||||||| ||||||||| |
|
|
| T |
46320677 |
gcttaattgcacttttggactcctatcttttcaaaagttgcggttatgga |
46320726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 340 - 388
Target Start/End: Complemental strand, 18590142 - 18590094
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||||||||||| |
|
|
| T |
18590142 |
gcttaattgcacttttggatccctatctttttaaaagttgtggttatgg |
18590094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 340 - 388
Target Start/End: Complemental strand, 40815178 - 40815130
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||||||||| |||||||| |
|
|
| T |
40815178 |
gcttaattgcacttttggacctctatcttttcaaaagttgcggttatgg |
40815130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 341 - 380
Target Start/End: Original strand, 7489511 - 7489550
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgt |
380 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
7489511 |
cttaattgcacttttggccccctatctttccaaaagttgt |
7489550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 379
Target Start/End: Complemental strand, 21932100 - 21932061
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
21932100 |
gcttaattgcactttttgccccctatcttttcaaaagttg |
21932061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 387
Target Start/End: Original strand, 27855564 - 27855611
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| ||||||| |
|
|
| T |
27855564 |
gcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
27855611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 341 - 388
Target Start/End: Complemental strand, 30289458 - 30289411
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||| |||||||| |
|
|
| T |
30289458 |
cttaattgcacttttggacccatatctttccaaaagttacggttatgg |
30289411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 342 - 389
Target Start/End: Original strand, 32037846 - 32037893
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatgga |
389 |
Q |
| |
|
||||||||| |||| ||||||||| ||| ||||||||||||||||||| |
|
|
| T |
32037846 |
ttaattgcatttttggacccctattttttcaaaagttgtggttatgga |
32037893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 379
Target Start/End: Original strand, 35580739 - 35580778
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
35580739 |
gcttaattgcacttttggccccctatctttccaaaagttg |
35580778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 921754 - 921808
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||| ||||||| ||| |||||||||||||||||| ||||||| |||||| |
|
|
| T |
921754 |
gcttaattacacttttgaacctctatctttccaaaagttgcggttatgaacccct |
921808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 386
Target Start/End: Original strand, 3383965 - 3384011
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttat |
386 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||||||||| |||||| |
|
|
| T |
3383965 |
gcttaattgcacttttggacctctatcttttcaaaagttgcggttat |
3384011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 9332906 - 9332956
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||| || | |||||||| ||||||||| |||||||||||| |
|
|
| T |
9332906 |
ttaattgcacttttggagctctatcttttcaaaagttgcggttatggaccc |
9332956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 342 - 392
Target Start/End: Original strand, 9356679 - 9356729
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||| || | |||||||| ||||||||| |||||||||||| |
|
|
| T |
9356679 |
ttaattgcacttttggagctctatcttttcaaaagttgcggttatggaccc |
9356729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 16491287 - 16491233
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||| ||||||| ||||||||| ||||||||| |||| |
|
|
| T |
16491287 |
gcttaattgcacttttggacctttatcttttcaaaagttgcggttatggatccct |
16491233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 23208309 - 23208363
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||| |||||| ||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
23208309 |
gcttaattatacttttggactcctatcttttcaaaagttgcggttatggacccct |
23208363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 34988091 - 34988145
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||| |||||| ||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
34988091 |
gcttaattatacttttggacccctatcttttcaaaagttgcggttatgaacccct |
34988145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 390
Target Start/End: Original strand, 38622404 - 38622454
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| ||||||||||||| || |||||| ||||||||| |
|
|
| T |
38622404 |
gcttaattgcacttttggacccctatcttttcagaagttgcagttatggac |
38622454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 42589421 - 42589475
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| |||||||| ||||||||| |||||||| ||||| |
|
|
| T |
42589421 |
gcttaattgcacttttggacttctatctttacaaaagttgcggttatggccccct |
42589475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 43677413 - 43677360
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
43677413 |
gcttaattgcacttttgga-ccctatcttttcaaaagttgcggttatgaacccct |
43677360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 340 - 377
Target Start/End: Complemental strand, 866456 - 866419
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagt |
377 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||| |
|
|
| T |
866456 |
gcttaattgcacttttggatccctatctttccaaaagt |
866419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 340 - 389
Target Start/End: Complemental strand, 4243439 - 4243390
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgga |
389 |
Q |
| |
|
|||||||||||||||| || |||||||||| |||||||| ||||||||| |
|
|
| T |
4243439 |
gcttaattgcacttttggatccctatctttttaaaagttgcggttatgga |
4243390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 342 - 387
Target Start/End: Original strand, 26434712 - 26434757
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
26434712 |
ttaattgcacttttgaacccctatctttccaaaagttacggttatg |
26434757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 342 - 379
Target Start/End: Complemental strand, 26932923 - 26932886
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
26932923 |
ttaattgcacttttggccccctatctttccaaaagttg |
26932886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 357 - 394
Target Start/End: Original strand, 30288225 - 30288262
Alignment:
| Q |
357 |
gacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
30288225 |
gacccctatctttccagaagttgcggttatggacccct |
30288262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 340 - 377
Target Start/End: Original strand, 33777167 - 33777204
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagt |
377 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
33777167 |
gcttaattgcacttttggacccctatctttctaaaagt |
33777204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 5225662 - 5225610
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| || |||||||||||| ||||||||| || ||| ||||| |
|
|
| T |
5225662 |
ttaattgcacttttggatccctatctttcctaaagttgtgattttggccccct |
5225610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 335 - 379
Target Start/End: Original strand, 26932579 - 26932622
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
26932579 |
aaaaggcttaattgcactttt-gacccctatcttttcaaaagttg |
26932622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 346 - 394
Target Start/End: Complemental strand, 45680396 - 45680348
Alignment:
| Q |
346 |
ttgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||| || |||||| ||| ||||||||| |||||||||||||| |
|
|
| T |
45680396 |
ttgcacttttggatccctattttttcaaaagttgcggttatggacccct |
45680348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0594 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: scaffold0594
Description:
Target: scaffold0594; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 5910 - 5851
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5910 |
aaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
5851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0594; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 5593 - 5647
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
5593 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
5647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 339 - 394
Target Start/End: Original strand, 81305 - 81360
Alignment:
| Q |
339 |
tgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
81305 |
tgcttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
81360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 81614 - 81560
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
81614 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
81560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 401023 - 400964
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
401023 |
aaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
400964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 340 - 389
Target Start/End: Original strand, 400705 - 400754
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgga |
389 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
400705 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatgga |
400754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0922 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0922
Description:
Target: scaffold0922; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 145 - 91
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
145 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
91 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0606 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0606
Description:
Target: scaffold0606; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 6869 - 6923
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6869 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
6923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: scaffold0474
Description:
Target: scaffold0474; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 8033 - 7979
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8033 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
7979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 335 - 391
Target Start/End: Original strand, 7717 - 7773
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7717 |
aaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
7773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 47; Significance: 1e-17; HSPs: 4)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 10940 - 10886
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10940 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
10886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 16230 - 16176
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16230 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
16176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 10629 - 10683
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
10629 |
gcttaattgcacttttagacccctatctttccaaaagttgcgattatggacccct |
10683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 15919 - 15973
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
15919 |
gcttaattgcacttttagacccctatctttccaaaagttgcgattatggacccct |
15973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 29651 - 29705
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29651 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
29705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 29963 - 29909
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29963 |
gcttaattgcacttttggacccctatctttccaaaagttacggttatggacccct |
29909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 238623 - 238677
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
238623 |
gcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
238677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 238936 - 238882
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
238936 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatgtacccct |
238882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 1e-17; HSPs: 121)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 1466811 - 1466865
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1466811 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
1466865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 1467120 - 1467066
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1467120 |
gcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
1467066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 15977521 - 15977467
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15977521 |
gcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
15977467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 19256901 - 19256847
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19256901 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
19256847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 21552542 - 21552596
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21552542 |
gcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
21552596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 36987725 - 36987671
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36987725 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
36987671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 332 - 393
Target Start/End: Original strand, 19025817 - 19025878
Alignment:
| Q |
332 |
tttaaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccc |
393 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
19025817 |
tttaaaaggcttaattgcactttttgacccctatcttttcaaaagttgcggttatgaacccc |
19025878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 1374801 - 1374853
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1374801 |
ttaattgcacttttagacccctatctttccaaaagttgcggttatggacccct |
1374853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 334 - 394
Target Start/End: Original strand, 31784247 - 31784307
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
31784247 |
taaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
31784307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 35699162 - 35699110
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35699162 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
35699110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 42445375 - 42445427
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42445375 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42445427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 24205290 - 24205349
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
24205290 |
aaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
24205349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 1375047 - 1375101
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1375047 |
gcttaattgcacttttggacccctatctttccaaaagttacggttatggacccct |
1375101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 17798849 - 17798903
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
17798849 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
17798903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 20494340 - 20494394
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20494340 |
gcttaattgcacttttggacccctatctttttaaaagttgtggttatggacccct |
20494394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 22194760 - 22194706
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
22194760 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
22194706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 22699457 - 22699511
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||| |||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22699457 |
gcttaattgtacttttggacccctatcttttcaaaagttgtggttatggacccct |
22699511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 23000821 - 23000767
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
23000821 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
23000767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 24895223 - 24895169
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
24895223 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
24895169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 25429923 - 25429977
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
25429923 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
25429977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 36987413 - 36987467
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
36987413 |
gcttaattgcacttttggacccctatctttccaaaagttgcgtttatggacccct |
36987467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 39642730 - 39642784
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
39642730 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
39642784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 40493957 - 40493903
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
40493957 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
40493903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 41071830 - 41071884
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41071830 |
gcttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
41071884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 41072140 - 41072086
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41072140 |
gcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
41072086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 336 - 394
Target Start/End: Original strand, 45126836 - 45126894
Alignment:
| Q |
336 |
aaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||||||| ||||||||| | ||||||||||| |||||||||||||| |
|
|
| T |
45126836 |
aaatgcttaattgcacttttggacccctatatatccaaaagttgcggttatggacccct |
45126894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 45127148 - 45127094
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45127148 |
gcttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
45127094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 1375397 - 1375344
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1375397 |
cttaattgaacttttggacccctatctttccaaaagttgcggttatggacccct |
1375344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 1375472 - 1375419
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
1375472 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
1375419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 40324941 - 40324888
Alignment:
| Q |
342 |
ttaattgcactttttg-acccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40324941 |
ttaattgcactttttggacccctatctttccaaaagttgcggttatggacccct |
40324888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 41829469 - 41829522
Alignment:
| Q |
340 |
gcttaattgcactttttg-acccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
41829469 |
gcttaattgcactttttggacccctatctttccaaaagttgcggttatggaccc |
41829522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 315021 - 315073
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
315021 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
315073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 17799139 - 17799087
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
17799139 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
17799087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 334 - 394
Target Start/End: Original strand, 39620540 - 39620600
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| |||||||||||||||| | |||||||||||||||||||| |||||||||||||| |
|
|
| T |
39620540 |
taaaaggcttaattgcacttttgggtccctatctttccaaaagttgcggttatggacccct |
39620600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 13485490 - 13485431
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
13485490 |
aaaaggcttaattgcacttttatacccctatcttttcaaaagttgcggttatggacccct |
13485431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 25430087 - 25430028
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
25430087 |
aaaaggcttaattgcacttttggacccctatctttccaaaagttgcagttatggccccct |
25430028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 391
Target Start/End: Original strand, 25887895 - 25887946
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
25887895 |
gcttaattgcacttttggacccttatctttccaaaagttgcggttatggacc |
25887946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 2382869 - 2382815
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
2382869 |
gcttaattgcacttttaaacccctatatttccaaaagttgcggttatggacccct |
2382815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 2936790 - 2936844
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
2936790 |
gcttaattgcacttttggacccttatcttttcaaaagttgcggttatggacccct |
2936844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 7464251 - 7464197
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
7464251 |
gcttaattgcacttttggactcctatctttccaaaagttacggttatggacccct |
7464197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 7537414 - 7537468
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
7537414 |
gcttaattgcacttttggacccctaactttccaaaagttgcggttacggacccct |
7537468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 9715161 - 9715107
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||| |||| ||||| |
|
|
| T |
9715161 |
gcttaattgcacttttggacccctatctttccaaaagttgcggtcatggccccct |
9715107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 13732479 - 13732425
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
13732479 |
gcttaattgcacttttggatccctatctttctaaaagttgcggttatggacccct |
13732425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 15977209 - 15977263
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||| ||||||| ||||||||||||| |
|
|
| T |
15977209 |
gcttaattgcacttttggacccctatttttccagaagttgtagttatggacccct |
15977263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 20436059 - 20436113
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
20436059 |
gcttaattgcacttttggacccctatcttttcaaaagttgcagttatggacccct |
20436113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 21552853 - 21552799
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
21552853 |
gcttaattgcacttttggacccatatcttttcaaaagttgcggttatggacccct |
21552799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 21843492 - 21843438
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
21843492 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
21843438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 22093236 - 22093290
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||| ||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
22093236 |
gcttaaatgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
22093290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 22093530 - 22093476
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
22093530 |
gcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
22093476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 335 - 389
Target Start/End: Original strand, 24894965 - 24895019
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatgga |
389 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||||||||| ||||||||| |
|
|
| T |
24894965 |
aaaatgcttaattgcacttttggatccctatcttttcaaaagttgcggttatgga |
24895019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 25888203 - 25888149
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
25888203 |
gcttaattgcacttttggacccctatctttacaaaagttacggttatggacccct |
25888149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 26717453 - 26717399
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
26717453 |
gcttaattgcacttttggacccatatctttccaaaagttgcggttatggccccct |
26717399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 34850969 - 34850915
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
34850969 |
gcttaattgcacttttggacccctatctttccaaaagttgcagttatggccccct |
34850915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 40493647 - 40493701
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
40493647 |
gcttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
40493701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 40506204 - 40506258
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||| |||||||| ||||| |
|
|
| T |
40506204 |
gcttaattgcacttttggaccccaatctttccaaaagttgcggttatggccccct |
40506258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 42445684 - 42445630
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
42445684 |
gcttaattgcacttttggatccctatctttctaaaagttgcggttatggacccct |
42445630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 342 - 391
Target Start/End: Original strand, 8519269 - 8519318
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
8519269 |
ttaattgcacttttgaacccctatctttccaaaagttgcggttatggacc |
8519318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 9484703 - 9484756
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
9484703 |
cttaattgcacttttaaacctctatctttccaaaagttgcggttatggacccct |
9484756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 340 - 385
Target Start/End: Complemental strand, 40445865 - 40445820
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggtta |
385 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
40445865 |
gcttaattgcacttttggacccctatctttctaaaagttgtggtta |
40445820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 45395233 - 45395286
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||| ||||||| |||||| |
|
|
| T |
45395233 |
cttaattgcacttttggacccctacctttccaaaagttgcggttatgtacccct |
45395286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 340 - 388
Target Start/End: Original strand, 3263036 - 3263084
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||||||| |
|
|
| T |
3263036 |
gcttaattgcacttttggacccctatctttctaaaagttgcggttatgg |
3263084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 390
Target Start/End: Original strand, 11362564 - 11362612
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||||||||| |
|
|
| T |
11362564 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggac |
11362612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 11367112 - 11367060
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
11367112 |
gcttaattgcacttttggacccttatctttccaaaagttgcggctatggaccc |
11367060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 340 - 392
Target Start/End: Original strand, 22136894 - 22136946
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
22136894 |
gcttaattgcacttttagacccctatctttccaaaagttacagttatggaccc |
22136946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 390
Target Start/End: Original strand, 24857886 - 24857934
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| |||||||||| |
|
|
| T |
24857886 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatggac |
24857934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 34123245 - 34123296
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
34123245 |
ttaattgcacttttggaccc-tatctttccaaaagttgcggttatggacccct |
34123296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 41829775 - 41829723
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
41829775 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
41829723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 11366799 - 11366854
Alignment:
| Q |
340 |
gcttaattgcactttttgacccc-tatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||| ||||||| |||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
11366799 |
gcttaattacacttttggaccccctatctttccaaaagttgcggttatggacccct |
11366854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 13123424 - 13123475
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||| |||||||||||| |
|
|
| T |
13123424 |
cttaattgcacttttggacccctatctttttaaaagttgaggttatggaccc |
13123475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 387
Target Start/End: Complemental strand, 30219018 - 30218971
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| ||||||| |
|
|
| T |
30219018 |
gcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
30218971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 391
Target Start/End: Original strand, 33004710 - 33004761
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||| |
|
|
| T |
33004710 |
gcttaattgcacttttggacccctatcttttcaaaagttgcagttatggacc |
33004761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 33005005 - 33004950
Alignment:
| Q |
340 |
gcttaattgcactttttga-cccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || ||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
33005005 |
gcttaattgcacttttggatcccctatcttttcaaaagttgcggttatggacccct |
33004950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 340 - 387
Target Start/End: Complemental strand, 36566763 - 36566716
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| ||||||| |
|
|
| T |
36566763 |
gcttaattgcacttctggacccctatctttccaaaagttgcggttatg |
36566716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 40711332 - 40711391
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| ||||||||| | |||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
40711332 |
aaaaggcttaattgtatttttggacccctatcttttcaaaagttgcggttatggacccct |
40711391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 3263328 - 3263274
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| |||||||||| |||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
3263328 |
gcttacttgcacttttggacccctatctttctaaaagttgcggttatggccccct |
3263274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 19473077 - 19473131
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| |||||||||||||| |||||||| |||||||| ||||| |
|
|
| T |
19473077 |
gcttaattgcatttttggacccctatctttctaaaagttgcggttatggccccct |
19473131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 342 - 388
Target Start/End: Complemental strand, 19473325 - 19473279
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||| |||||||| |
|
|
| T |
19473325 |
ttaattgcacttttggacccttatctttccaaaagttgcggttatgg |
19473279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 21568237 - 21568183
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| || |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
21568237 |
gcttaattgcatttttggatccctatcttttcaaaagttgcggttatggacccct |
21568183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 22194449 - 22194503
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||| || |||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
22194449 |
gcttaatttcatttttggacccctatcttttcaaaagttgcggttatggacccct |
22194503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 24858188 - 24858134
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
24858188 |
gcttaattgcacttttggatccctatcttttcaaaagttgcggttatgaacccct |
24858134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 31784563 - 31784509
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| || |||||||||| ||||||||| |||||||||||||| |
|
|
| T |
31784563 |
gcttaattgcatttttggatccctatcttttcaaaagttgcggttatggacccct |
31784509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 36589732 - 36589786
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| ||||||||| |||||||| ||||| |
|
|
| T |
36589732 |
gcttaattgcacttttggacccttatcttttcaaaagttgcggttatggccccct |
36589786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 386
Target Start/End: Original strand, 38731280 - 38731326
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttat |
386 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||| |
|
|
| T |
38731280 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttat |
38731326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 390
Target Start/End: Complemental strand, 39245977 - 39245927
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| | |||||||| |
|
|
| T |
39245977 |
gcttaattgcacttttggacccatatctttccaaaagttgcgattatggac |
39245927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 40324635 - 40324689
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||| | |||||||||||| |
|
|
| T |
40324635 |
gcttaattgcacttttggatccctatcttttcaaaagttgcgattatggacccct |
40324689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 45395550 - 45395496
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || ||||||||||| |||| ||| |||||||||||||| |
|
|
| T |
45395550 |
gcttaattgcacttttggatccctatctttctaaaaattgcggttatggacccct |
45395496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 342 - 387
Target Start/End: Complemental strand, 8739139 - 8739094
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| ||||||| |
|
|
| T |
8739139 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
8739094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 334 - 387
Target Start/End: Complemental strand, 19368811 - 19368758
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
||||| |||||||||||||||| ||||| ||||||| ||||||||| ||||||| |
|
|
| T |
19368811 |
taaaaggcttaattgcacttttggacccttatcttttcaaaagttgcggttatg |
19368758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 340 - 377
Target Start/End: Original strand, 26717159 - 26717196
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagt |
377 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26717159 |
gcttaattgcacttttggacccctatctttccaaaagt |
26717196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 342 - 391
Target Start/End: Complemental strand, 34981692 - 34981643
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
||||||||| |||| ||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
34981692 |
ttaattgcatttttagacccctatcttttcaaaagttgcggttatggacc |
34981643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 334 - 379
Target Start/End: Complemental strand, 36286472 - 36286427
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
||||| |||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
36286472 |
taaaaggcttaattgcacttttggccccctatctttccaaaagttg |
36286427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 340 - 388
Target Start/End: Complemental strand, 315315 - 315267
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| |||||||| |||||||| |
|
|
| T |
315315 |
gcttaattgcacttttggacccatatctttctaaaagttgcggttatgg |
315267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 19026127 - 19026075
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||| |||||| ||||||| |
|
|
| T |
19026127 |
ttaattgcacttttgaatccctatctttccaaaagttgcggttatagacccct |
19026075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 23000530 - 23000582
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||| ||| ||||||||||||| |||||||| ||||| |
|
|
| T |
23000530 |
ttaattgcacttttggacccttatttttccaaaagttgcggttatggccccct |
23000582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 340 - 388
Target Start/End: Complemental strand, 36590024 - 36589976
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| ||||||||| |||||||| |
|
|
| T |
36590024 |
gcttaattgcacttttggacccttatcttttcaaaagttgcggttatgg |
36589976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 39431172 - 39431224
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| |||||||||||||| |
|
|
| T |
39431172 |
ttaattgcacttttgaacttctatctttccaaaagttgcggttatggacccct |
39431224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 2937105 - 2937047
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| ||||||||||| |||| |||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
2937105 |
aaaaggcttaattgca-ttttggacctctatctttctaaaagttgcggttatggacccct |
2937047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 7463949 - 7464000
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||| |||| |
|
|
| T |
7463949 |
cttaattgcacttttgaacccctatctttttaaaagttgtggttatgtaccc |
7464000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 379
Target Start/End: Original strand, 10857340 - 10857379
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
10857340 |
gcttaattgcacttttggccccctatctttccaaaagttg |
10857379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 379
Target Start/End: Original strand, 16865320 - 16865359
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
16865320 |
gcttaattgcacttttggccccctatctttccaaaagttg |
16865359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 351 - 394
Target Start/End: Complemental strand, 24205597 - 24205554
Alignment:
| Q |
351 |
ctttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
24205597 |
cttttggacccctatcttttcaaaagttgcggttatggacccct |
24205554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 379
Target Start/End: Complemental strand, 32661747 - 32661708
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
32661747 |
gcttaattgcacttttggccccctatctttccaaaagttg |
32661708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 379
Target Start/End: Original strand, 34600548 - 34600587
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
34600548 |
gcttaattgcacttttggccccctatctttccaaaagttg |
34600587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 341 - 388
Target Start/End: Original strand, 36566605 - 36566652
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
||||||||||||| | ||||||||||||| ||||||||| |||||||| |
|
|
| T |
36566605 |
cttaattgcacttctggacccctatcttttcaaaagttgcggttatgg |
36566652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 387
Target Start/End: Original strand, 40445574 - 40445621
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||| |||| ||||||| |
|
|
| T |
40445574 |
gcttaattgcacttttggacccatatctttccaaacgttgcggttatg |
40445621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 341 - 379
Target Start/End: Complemental strand, 4094870 - 4094832
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
4094870 |
cttaattgcactttttgccccctatcttttcaaaagttg |
4094832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 20436365 - 20436311
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||| ||||||| ||||||||| ||| ||||||||| ||||||||||||| |
|
|
| T |
20436365 |
gcttaattacacttttggacccctattttttcaaaagttgctgttatggacccct |
20436311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 390
Target Start/End: Complemental strand, 34123553 - 34123503
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggac |
390 |
Q |
| |
|
|||||||||||||||| ||||||||| ||| |||||||| |||||||||| |
|
|
| T |
34123553 |
gcttaattgcacttttagacccctattttttaaaaagttgcggttatggac |
34123503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 342 - 388
Target Start/End: Original strand, 34850680 - 34850726
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||| ||||| ||| ||||||||||||| |||||||| |
|
|
| T |
34850680 |
ttaattgcacttttggacccttatttttccaaaagttgcggttatgg |
34850726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 38731591 - 38731537
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| ||||||||| ||||| ||||||| |
|
|
| T |
38731591 |
gcttaattgcacttttggactcctatcttttcaaaagttgcagttattgacccct |
38731537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 39431481 - 39431427
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
39431481 |
gcttaattgcacttttgaacctctatctttttaaaagttgcggttatggacccct |
39431427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 342 - 379
Target Start/End: Complemental strand, 3414910 - 3414873
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3414910 |
ttaattgcacttttgaacccctatctttccaaaagttg |
3414873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 341 - 394
Target Start/End: Complemental strand, 11362872 - 11362819
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||| |||||| |||||||||| || ||||||||| |||||||||||||| |
|
|
| T |
11362872 |
cttaattatacttttggacccctatcatttcaaaagttgcggttatggacccct |
11362819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 341 - 394
Target Start/End: Original strand, 12542141 - 12542194
Alignment:
| Q |
341 |
cttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||||| | ||||||||||| ||||||||||| || ||| ||||| |
|
|
| T |
12542141 |
cttaattgcacttttggccccctatcttttcaaaagttgtgattttggccccct |
12542194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 340 - 385
Target Start/End: Original strand, 17096912 - 17096957
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggtta |
385 |
Q |
| |
|
|||||||||||||||| || ||||| |||||||||||||| ||||| |
|
|
| T |
17096912 |
gcttaattgcacttttggatccctaactttccaaaagttgcggtta |
17096957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 340 - 385
Target Start/End: Complemental strand, 17102621 - 17102576
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggtta |
385 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||| ||||| |
|
|
| T |
17102621 |
gcttaattgcacttttgaacccctaactttccaaaagttgcggtta |
17102576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 342 - 387
Target Start/End: Complemental strand, 24365180 - 24365135
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
||||||||| |||| |||| |||||||||||||||||| ||||||| |
|
|
| T |
24365180 |
ttaattgcatttttggacctctatctttccaaaagttgcggttatg |
24365135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 334 - 394
Target Start/End: Original strand, 5036504 - 5036564
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| |||||||||||||||| ||| | ||||||| |||||||| |||||||| ||||| |
|
|
| T |
5036504 |
taaaaggcttaattgcacttttggactcttatctttttaaaagttgcggttatggccccct |
5036564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 340 - 388
Target Start/End: Original strand, 9714869 - 9714917
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||| || ||||| |
|
|
| T |
9714869 |
gcttaattgcacttttgaactcctatctttccaaaagttgcggctatgg |
9714917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 340 - 384
Target Start/End: Complemental strand, 10741390 - 10741346
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggtt |
384 |
Q |
| |
|
|||||||||||||||| | ||||||||||| ||||||||| |||| |
|
|
| T |
10741390 |
gcttaattgcacttttggccccctatcttttcaaaagttgcggtt |
10741346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 335 - 379
Target Start/End: Original strand, 28451635 - 28451679
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||| |||||||||||||||| | |||||||||||| |||||||| |
|
|
| T |
28451635 |
aaaaagcttaattgcacttttggccccctatctttctaaaagttg |
28451679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 139484 - 139432
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
139484 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
139432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 139178 - 139230
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||| |||||||||||||| |
|
|
| T |
139178 |
ttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
139230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 45; Significance: 2e-16; HSPs: 3)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 340 - 388
Target Start/End: Original strand, 78991 - 79039
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
78991 |
gcttaattgcacttttggacccctatctttccaaaagttgtggttatgg |
79039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 79299 - 79245
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
79299 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
79245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 12975 - 12916
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
12975 |
aaaaggcttaattgcacttttggacccctatctttctaaaagttgcggttatggatccct |
12916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 20943 - 20884
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
20943 |
aaaaggcttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
20884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 20623 - 20681
Alignment:
| Q |
340 |
gcttaattgcactttttgacccct----atctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||| |||||| ||||||||| |||||||||||||| |
|
|
| T |
20623 |
gcttaattgcacttttggacccctccctatcttttcaaaagttgcggttatggacccct |
20681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0777 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0777
Description:
Target: scaffold0777; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 182 - 128
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
182 |
gcttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: scaffold0352
Description:
Target: scaffold0352; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 9948 - 10002
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
9948 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
10002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 10249 - 10195
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| |||||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
10249 |
gcttaattgcatttttggacccctatctttctaaaagttgcggttatggatccct |
10195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 16066 - 16012
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
16066 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
16012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0213 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: scaffold0213
Description:
Target: scaffold0213; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 21359 - 21305
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
21359 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
21305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0213; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 21067 - 21121
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| ||| | |||||| ||||| |
|
|
| T |
21067 |
gcttaattgcacttttggatccctatctttccaaaatttgcgattatggccccct |
21121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 22296 - 22350
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
22296 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
22350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 22588 - 22534
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
22588 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggccccct |
22534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1171 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 1)
Name: scaffold1171
Description:
Target: scaffold1171; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 340 - 393
Target Start/End: Original strand, 820 - 873
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccc |
393 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
820 |
gcttaattgcacttttggacccctatctttccaaaagttgcgtttatggacccc |
873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0951 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 1)
Name: scaffold0951
Description:
Target: scaffold0951; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 342 - 391
Target Start/End: Original strand, 3708 - 3757
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacc |
391 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3708 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacc |
3757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0283 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0283
Description:
Target: scaffold0283; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 1187 - 1239
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
1187 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
1239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0283; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 1494 - 1442
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||| ||||||||| ||||||||| |||||||||||||| |
|
|
| T |
1494 |
ttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
1442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 3)
Name: scaffold0182
Description:
Target: scaffold0182; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 392
Target Start/End: Complemental strand, 20926 - 20874
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggaccc |
392 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
20926 |
gcttatttgcacttttggacccctatctttccaaaagttgcggttatggaccc |
20874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 20596 - 20650
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
20596 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatgaacccct |
20650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 342 - 394
Target Start/End: Original strand, 12050 - 12102
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||| |||||||| ||||||||| |||||||||||||| |
|
|
| T |
12050 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
12102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0102 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 14615 - 14563
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
14615 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
14563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0693
Description:
Target: scaffold0693; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 387
Target Start/End: Complemental strand, 4833 - 4786
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
4833 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
4786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0592 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0592
Description:
Target: scaffold0592; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 340 - 387
Target Start/End: Complemental strand, 9022 - 8975
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatg |
387 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9022 |
gcttaattgcatttttggacccctatctttccaaaagttgtggttatg |
8975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 335 - 394
Target Start/End: Original strand, 75106 - 75165
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| |||||||||||||||| ||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
75106 |
aaaaggcttaattgcacttttggacccctatttttccaaaagttgccgttatggacccct |
75165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 75385 - 75333
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||| ||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
75385 |
ttaattgcacttttggactcctatcttttcaaaagttgcggttatggatccct |
75333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 4)
Name: scaffold0272
Description:
Target: scaffold0272; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Complemental strand, 10873 - 10819
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
10873 |
gcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
10819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 335 - 394
Target Start/End: Complemental strand, 21166 - 21107
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||| ||||||||||| |||| ||||||||||||||||||||||| ||| |||| ||||| |
|
|
| T |
21166 |
aaaaggcttaattgcatttttggacccctatctttccaaaagttgcggtaatggccccct |
21107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 386
Target Start/End: Original strand, 20869 - 20915
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttat |
386 |
Q |
| |
|
|||||||||||||||| |||| |||||||| ||||||||| |||||| |
|
|
| T |
20869 |
gcttaattgcacttttggacctctatcttttcaaaagttgcggttat |
20915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 334 - 379
Target Start/End: Original strand, 10554 - 10599
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||| | ||||||| |
|
|
| T |
10554 |
taaaaggcttaattgcacttttggacccctatcttttccaaagttg |
10599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0227
Description:
Target: scaffold0227; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 764 - 818
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
764 |
gcttaattgcatttttagacccctatctttccaaaagttgcggttacggacccct |
818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 335 - 385
Target Start/End: Original strand, 21834 - 21884
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttgtggtta |
385 |
Q |
| |
|
|||| |||||||||||||||| |||||||| |||||||||||||| ||||| |
|
|
| T |
21834 |
aaaaggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
21884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1067 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: scaffold1067
Description:
Target: scaffold1067; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 334 - 394
Target Start/End: Original strand, 1350 - 1410
Alignment:
| Q |
334 |
taaaatgcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||| |||||||||||||||| || |||||||||| ||||||||| ||| |||| ||||| |
|
|
| T |
1350 |
taaaaggcttaattgcacttttggatccctatcttttcaaaagttgcggtcatggccccct |
1410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1067; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 342 - 394
Target Start/End: Complemental strand, 1645 - 1594
Alignment:
| Q |
342 |
ttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
1645 |
ttaattgcacttttggaccc-tatctttccaaaagttgcggttatggccccct |
1594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 344 - 388
Target Start/End: Complemental strand, 26555 - 26511
Alignment:
| Q |
344 |
aattgcactttttgacccctatctttccaaaagttgtggttatgg |
388 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| |||||||| |
|
|
| T |
26555 |
aattgcacttttggacctctatctttccaaaagttgcggttatgg |
26511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 340 - 394
Target Start/End: Original strand, 26264 - 26318
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
|||||||||||||||| || ||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
26264 |
gcttaattgcacttttgaactcctatcttttcaaaagttgcggttatggccccct |
26318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 335 - 379
Target Start/End: Complemental strand, 122647 - 122603
Alignment:
| Q |
335 |
aaaatgcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||| |||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
122647 |
aaaaggcttaattgcacttttggccccctatctttccaaaagttg |
122603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 343 - 394
Target Start/End: Original strand, 3787 - 3837
Alignment:
| Q |
343 |
taattgcactttttgacccctatctttccaaaagttgtggttatggacccct |
394 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||| ||||||||| |||| |
|
|
| T |
3787 |
taattgcacttttggaccc-tatctttccaaaagttgcggttatggaaccct |
3837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 340 - 379
Target Start/End: Original strand, 31980 - 32019
Alignment:
| Q |
340 |
gcttaattgcactttttgacccctatctttccaaaagttg |
379 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
31980 |
gcttaattgcacttttggccccctatctttccaaaagttg |
32019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University