View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11309_low_25 (Length: 311)
Name: NF11309_low_25
Description: NF11309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11309_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 298
Target Start/End: Original strand, 21780566 - 21780844
Alignment:
| Q |
19 |
aattttaccttgtttta-acttactaatctttcatgcatgttttgaccaattttgactaaaaatcaatcacctatgtagctaattttaattacgtgacaa |
117 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21780566 |
aattttaccttgttttacacttactagtctttcatgcatgttttgaccaattttgactaaaaatcaatcacctatgtagctaattttaattacgtgacaa |
21780665 |
T |
|
| Q |
118 |
taagacccatgtgtttttagagagaagacatacctnnnnnnnnnnnnaacttaacatgctttcagtcacccaaactagggtttcaccttggttcagcggc |
217 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
21780666 |
taagacccatgtgtttttagagagaaggaggaccttctctctctg--aacttaacatgctttcgttcacccaaactagggtttcaccttggttcagcggc |
21780763 |
T |
|
| Q |
218 |
ggcaaatcaacccatatcttcgtgatttgcctttcccgaccatatgggtcgccgcacctaggtgttcctagtccctcccct |
298 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21780764 |
ggcaaatcaacccatatcttcgtgatctgcctttcccgaccatatgggtcgccgcacctaggtgttcctagtccctcccct |
21780844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 165 - 304
Target Start/End: Original strand, 24375392 - 24375531
Alignment:
| Q |
165 |
aacttaacatgctttcagtcacccaaactagggtttcaccttggttcagcggcggcaaatcaacccatatcttcgtgatttgcctttcccgaccatatgg |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
24375392 |
aacttaacatgctttcagtcacccaaactagggtttcaccttggttcagcggcggcaaatcaacccagatcttcgtgatctgcctttcccgaccatatgg |
24375491 |
T |
|
| Q |
265 |
gtcgccgcacctaggtgttcctagtccctcccctttgctt |
304 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
24375492 |
gtcgccgcacctaggtgttcccagtccctcccctctgctt |
24375531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 165 - 304
Target Start/End: Complemental strand, 9106756 - 9106617
Alignment:
| Q |
165 |
aacttaacatgctttcagtcacccaaactagggtttcaccttggttcagcggcggcaaatcaacccatatcttcgtgatttgcctttcccgaccatatgg |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
9106756 |
aacttaacatgctttcagtcacccaaactagggtttcaccatggttcaacgacggcaaatcaacccagatcttcgtgatctgcctttcccgaccatatgg |
9106657 |
T |
|
| Q |
265 |
gtcgccgcacctaggtgttcctagtccctcccctttgctt |
304 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9106656 |
gtcgccacacctaggtgttcctagtccctcccctttgctt |
9106617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 8e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 209 - 300
Target Start/End: Complemental strand, 32021815 - 32021724
Alignment:
| Q |
209 |
ttcagcggcggcaaatcaacccatatcttcgtgatttgcctttcccgaccatatgggtcgccgcacctaggtgttcctagtccctccccttt |
300 |
Q |
| |
|
||||||||||||||| ||||||| ||| ||||||| |||||| |||||||||||||||| || | |||||||||||||||| | |||||||| |
|
|
| T |
32021815 |
ttcagcggcggcaaaacaacccagatcatcgtgatctgccttccccgaccatatgggtcaccactcctaggtgttcctagttcttccccttt |
32021724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University