View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11309_low_27 (Length: 278)

Name: NF11309_low_27
Description: NF11309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11309_low_27
NF11309_low_27
[»] chr2 (2 HSPs)
chr2 (146-269)||(37549996-37550119)
chr2 (19-66)||(37549869-37549916)


Alignment Details
Target: chr2 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 146 - 269
Target Start/End: Original strand, 37549996 - 37550119
Alignment:
146 ttggatttgtaatcagtggtggagattgtgattctgccggaggattaggtggattgctactgacagggttgttaagagtaaaaggaggagtaggagaatt 245  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||    
37549996 ttggatttgtaatcactggtggagattgtgattctgccggaggattaggtggattactactgacagggttgttaagagtaaaaggaggagtaggagagtt 37550095  T
246 gaaattcggctgcggaaaagaacc 269  Q
    |||||||||| |||||||||||||    
37550096 gaaattcggcggcggaaaagaacc 37550119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 37549869 - 37549916
Alignment:
19 gtaggcgtactaggcggctccgccacactcggcggtgattgcaccaac 66  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
37549869 gtaggcgtactaggcggctccgccacactcggcggtgattgcaccaac 37549916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University